Labshake search
Citations for Merck :
1401 - 1450 of 1775 citations for HDM Fluorescent Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 2 μl of the enzyme β-glucuronidase (from Helix from Pomatia enzyme aqueous solution, ≥ 100.000 units/mL; Merck, Darmstadt, Germany) to deconjugate DEHP metabolites and BPA ...
-
bioRxiv - Microbiology 2020Quote: ... and the other stored at −80 °C in a sterile 2 ml cryovial containing 1 ml of a 30 % glycerol solution, prepared by diluting glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Immunology 2021Quote: Cytokine and chemokine levels produced by PCLS after 2 dpi were assessed in a Multiplex assay in supernatants (dilution 1:2) with MILLIPLEX® Bovine Cytokine/Chemokine Panel 1 (BCYT1-33K-PX15, Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... tumors were enzymatically digested with 2,000 U/mL of DNase I and 2 mg/mL of collagenase IV (both from Sigma Aldrich, Merck, Israel) in HBSS for 30 min 37 □ ...
-
bioRxiv - Neuroscience 2021Quote: ... the kinetics of ROS production was evaluated for 2 h after the addition of 2,7-dichloro-diidrofluorescineacetate (DCFH-DA, Merck, Darmstadt, Germany) using the Microplate Reader GloMax fluorimeter (Promega Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fractions corresponding to the elution peak were selected and concentrated to 2-50 mg/mL through the use of Amicon® Ultra-15 Centrifugal Unit (Merck), frozen and stored at −80°C for downstream experiments ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 5,000 Da ...
-
bioRxiv - Cell Biology 2022Quote: ... femurs and tibias of C57BL/6J mice were extracted and crushed on a mortar in PBS supplemented with 4%FBS and 2 mM EDTA and filtered through 0.45μm strainers (Merck Millipore, Cat#SLHV033RB). For B cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Plant Biology 2023Quote: ... and concentrated to 2 mg chlorophyll mL-1 using a 100-kDa molecular-weight cut-off centrifugal filter unit (Amicon Ultra-15, Merck Millipore). A 3 µl volume of the sample was applied to a glow-discharged holey carbon grid (GIG ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Zoology 2023Quote: ... it was fractionated into the different fatty acid classes over an activated silicic acid column (heated at 120ºC for 2 h; Merck Kieselgel 60) via eluting with 7 ml chloroform ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfectants with stably integrated GOI were then selected based on their resistance to G418 (0.5 mg/ml, 1-2 weeks, Merck, Cat.N. G8168). To induce the expression of the GOI the cells were treated with doxycycline (2 μg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and incubated at 28°C shaking at 200 rpm for 2–3 h before plating on LB agar supplemented with 50 µg/ml Kanamycin (Merck Millipore). The plates were incubated for 2– 3 days at 28°C ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The routinely used growth medium was composed of yeast extract (1%(w/v)) (Fisher BioReagents™) and casein peptone (2%(w/v)) (Merck), and was supplemented with 2% (w/v ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: Cells were homogenized in 20 mM Tris-HCl buffer (pH 7.2, 0.2 mM EGTA, 5 mM β-mercaptoethanol, 2% (v/v) antiprotease cocktail (Merck KGaA, Germany), 1 mM PMSF ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck, P5726-1ML and P0044-1ML, respectively) and 1:100 protease inhibitor cocktail (Sigma/Merck ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2024Quote: ... U-937 cells were maintained in RPMI-1640 medium supplemented with 4.5 g/L glucose, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1.0 mM sodium pyruvate (Sigma-Aldrich; Merck KGaA), 10% fetal bovine serum (Hyclone ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nuclei pellet was washed once in 5 mL of Honda buffer then purified on a Percoll density gradient as follows: 2 mL of 75% Percoll (Merck, P7828) in Honda buffer topped with 2 mL of 40% Percoll in Honda buffer topped with the nuclei pellet resuspended in Honda buffer in a 15 mL tube ...
-
bioRxiv - Cell Biology 2020Quote: ... ChIP assays were performed using a specific kit (Merck Millipore, Darmstadt, Germany). After crosslinking ...
-
bioRxiv - Cell Biology 2020Quote: PP2A activity were measured by PP2A phosphatase activity assay kit from Merck Millipore (PP2A immunoprecipitation phosphatase assay kit ...
-
bioRxiv - Microbiology 2021Quote: ... the serum levels of total GLP-1 (ELISA kit, Merck, Darmstadt, Germany) and IAA (ELISA kit ...
-
bioRxiv - Microbiology 2021Quote: ... and a solution of XTT/PMS (Cell Proliferation Kit II; Merck, Germany) and culture medium was added to the wells ...
-
bioRxiv - Cancer Biology 2020Quote: ... the ApopTag® Red In Situ Apoptosis Detection Kit (S7165, Merck Millipore) was also used to label apoptotic cells following Wells and Johnston protocol (Wells and Johnston ...
-
bioRxiv - Cell Biology 2021Quote: RIP assays were performed using a Magna Nuclear RIP Kit from Merck Millipore (17-10520 ...
-
bioRxiv - Cell Biology 2021Quote: The Magna RNA-binding protein immunoprecipitation kit (Merck Millipore, Billerica, MA, USA) was applied for the assay ...
-
bioRxiv - Cell Biology 2021Quote: Co-IP was performed using Protein G Immunoprecipitation Kit (Merck, Cat # IP50) as per the manufacturer's protocol ...
-
bioRxiv - Molecular Biology 2022Quote: PLA detection was performed using a Duolink In Situ Orange Kit (Merck) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: We performed the proximity ligation assay129 using the Duolink PLA Kit (Merck) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was purified using the GenElute Mammalian total RNA Miniprep kit (MERCK). Samples from cell culture were harvested in the RNA extraction buffer supplemented with 10mM ß-ME ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cell viability was studied using Cell Counting Kit-8 (CCK8, Merck, Germany). VeroE6 cells were seeded at 10,000 cells per well of flat bottom 96-well plates (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting RNA was then subjected to amplification (Merck WTA2 Amplification Kit) to produce cDNA that was subsequently purified by column capture (Qiagen QiaQuick PCR purification kit ...
-
bioRxiv - Immunology 2021Quote: QCM Boyden chamber chemotaxis neutrophil migration assay kits were purchased from Merck Millipore (ECM505 ...
-
bioRxiv - Microbiology 2021Quote: ... KOD Xtreme Hotstart DNA polymerase kit was obtained from Merck (Darmstadt, Germany). T4 DNA ligase was obtained from New England Biolabs (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ELISA kits were used for measurements Growth Hormone (Merck-SIGMA EZRMGH-45K) according to manufacturers’ instructions.
-
bioRxiv - Immunology 2022Quote: ... or with vaccine RNAs using RiboJuice™ mRNA Transfection Kit (Merck Millipore) according to the manufacturer’s instructions and incubated for 18 h ...
-
bioRxiv - Molecular Biology 2023Quote: Duolink™ In Situ Red Starter Kit Mouse/Rabbit (Merck, DUO92101-1KT) was used to detect protein-protein interactions ...