Labshake search
Citations for Merck :
1401 - 1450 of 4780 citations for 3 Methyl 1 6 naphthyridine 2 carboximidamide hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 2 was determined by staining with the DNA dye Hoechst 33258 (861405, Merck) as described previously (Saga et al. ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Immunology 2024Quote: ... Dimethyl 2-oxoglutarate (DM-OG) was purchased from Merck (cat no: 349631-5G) and added to the culture medium at 2mM and 4mM final concentrations.
-
bioRxiv - Synthetic Biology 2024Quote: ... magnesium sulfate : 2 mM MgSO4 (Merck/Sigma-Aldrich, CAS number : 7488-88-9), (iii ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-HES-1 (1:500, 1% casein, #AB5702, Millipore, Merck, Darmstadt, Germany), anti-LRP6 (1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% glutamine and 1% penicillin/streptomycin (Merck). Fascin KD cells were selected and maintained using puromycin ...
-
bioRxiv - Neuroscience 2020Quote: ... GluA1 (1:250-1:500; Merck Millipore) and RTP801 (1:100 ...
-
bioRxiv - Biophysics 2024Quote: ... 1 µL of 1:1000 fluorescein (Merck) was added to a well and incubated for 10 mins before observation ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...
-
bioRxiv - Biophysics 2020Quote: ... 105 cells were seeded on the upper chamber of 24 well plate cell culture inserts containing 3 µm pores (Cat # 353096, Merck). The inserts were coated with rat-tail collagen I ...
-
bioRxiv - Cell Biology 2020Quote: ... Viruses were collected from the supernatant 24 hours later and cleared by centrifugation at 2000 rpm for 3 minutes followed by filtration with 0.45 µm PVDF syringe filter units (Merck, #SLHV033RS). Cleared supernatants were titrated by plaque assay using BHK-21 cells.
-
bioRxiv - Evolutionary Biology 2020Quote: Larvae were raised as described above until 11 dpf and deeply anesthetized with 160 mg/l of Tricaine (Ethyl 3-aminobenzoate methanesulfonate salt, MS-222, Merck) before dissecting their pectoral fins ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were permeabilized with 0.1 % Triton-X100 in PBS for 20 min at RT and samples were blocked with freshly prepared 3 % bovine serum albumin (BSA, Merck) in PBS for 1 h at RT ...
-
bioRxiv - Molecular Biology 2021Quote: Heat-mediated antigen retrieval was performed for 3 min at 99°C in a 40mM trisodium citrate (Merck, Darmstadt, Germany) solution ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biochemistry 2020Quote: ... Chromatographic separation of AAs was achieved by applying 3 μl of dissolved sample on a SeQuant ZIC-HILIC column (3.5 μm particles, 100 × 2.1 mm) (Merck, Darmstadt, Germany), combined with a Javelin particle filter (Thermo Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Cell Biology 2021Quote: Cells were sonicated at low power for 3 s and loaded onto a commercial microfluidics system (Y04C-02 plates, CellASIC ONIX2 system, Merck). While loading the cells ...
-
bioRxiv - Biochemistry 2020Quote: ... each N-Cdh sample was desalted against PBS using Amicon centrifugal filters with a 3 kDa molecular weight cutoff according to the manufacturer’s protocol (Merck-Millipore). Unprocessed xCGE-LIG N-glycocomics raw data are available upon request.
-
bioRxiv - Bioengineering 2021Quote: ... 99%+, Figure S1(d)), and dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP, 42% solution in methanol) were obtained from Merck–Sigma Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 100 μL aliquots were removed and the reaction was stopped using a 3 KDa nominal molecular weight limit (NMWL) centrifuge filter (Merck Amicon Ultra 0.5mL Centrifugal Filters ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Major peaks were desalted by RP-HPLC using an Ascentis C18 column (3 μm, 4.6mm ID x 15 cm, Sigma-Merck, Germany) using peak-based collection (slope) ...
-
bioRxiv - Systems Biology 2020Quote: ... The resultant pellets were resuspended in 3% acetonitrile + 0.1% trifluoroacetic acid and peptide quantification performed using the Direct Detect system (Merck Millipore). Protein samples were normalized then vacuum concentrated in preparation for mass spectrometry.
-
bioRxiv - Cell Biology 2020Quote: ... Cell medium was replaced with 3 mL medium containing 20 μL of the purified lentivirus and 3μl polybrene transfection reagent (Merck Millipore). Medium was supplemented with 10 µg/mL puromycin for selection of successfully transduced cells two to three days after transduction.
-
bioRxiv - Cell Biology 2022Quote: ... The remaining media was then concentrated down to 500 uL using a falcon tube sized 3 kDa amicon column (UFC900308; Merck) spun at 4000 xg and 4°C for approximately 1 h ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Bioengineering 2022Quote: ... 100 nM of RNA polyhedra samples folded in TE/Mg2+/Na+ buffer were concentrated four times using 3 kDa MWCO Amicon Ultra centrifugal filters (Merck). 5 µl of the concentrated sample was applied on 300 mesh Cu grids coated with lacey carbon (Agar Scientific) ...
-
bioRxiv - Biochemistry 2022Quote: ... Chromatography was performed on a zwitterionic (ZIC) column with phosphocholine phase (ZIC-cHILIC, 2.1 mm i.d. x 150 mm, 3 μm; Merck SeQuant, Sweden) [38] ...
-
bioRxiv - Biophysics 2020Quote: ... The Q column flow-through containing nsp8 or nsp7 was concentrated using a MWCO 3 kDa Amicon Ultra Centrifugal Filter (Merck) and applied to a HiLoad S200 16/600 pg equilibrated in size exclusion buffer (150 mM NaCl ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The five eluted aliquots were then concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK) and desalted with filtered water to remove urea and salts ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... ssDNA was eluted and concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK), as described earlier ...
-
bioRxiv - Biophysics 2022Quote: ... Annealed samples were exchanged to NMR buffer (20 mM potassium phosphate, pH 7.0) using 3 kDa centrifugal filters (Amicon, Merck Inc.) spun at 4000 g and 4 °C to a final volume of 250 µL ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3 μg proteins were separated by SDS-PAGE and electrotransferred onto Immobilon®-P transfer membranes (Merck Millipore, MA, USA), blocked with 5% skim milk in Tris-buffered saline with 5% Tween 20 (TBST) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The purest and most concentrated fractions were then dialyzed by employing a 3 kDa membrane D-Tube Dialyzer (Merck, Germany) in PBS buffer (200 mM NaCl ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Chromatographic separation was carried out on an Agilent 1200 series quaternary HPLC system using a Chromolith Performance RP18-e column (100×3 mm) from Merck operated a temperature of 45°C with 1 mM ammonium formate in water containing 0.1% FA as mobile phase A and 1 mM ammonium formate in 95/5 (vol/vol ...
-
bioRxiv - Biochemistry 2021Quote: ... adjusted to pH 5.8 using 3 M HCl and filtered with 0.2 μm nylon membrane filters (GNWP04700, 0.2 μm pore size, Merck Millipore Ltd.), while mobile phase B consisted of 100% methanol ...
-
bioRxiv - Biochemistry 2021Quote: ... adjusted to pH 8 using 3 M HCl and filtered with 0.2 μm nylon membrane filters (GNWP04700, 0.2 μm pore size, Merck Millipore Ltd.), while mobile phase B consisted of 100% methanol (method described in Table 2) ...
-
bioRxiv - Immunology 2021Quote: ... 300 µL of saliva sample was mixed with 200 µL of 100 mM Tris-HCl buffer (pH 8.5; Nippon Gene Co., Ltd.) in an Amicon Ultra-0.5 Centrifugal Filter Unit (3 kDa; Merck Millipore Ltd), and the mixture was spun down at 14,000 g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... microglia were isolated and cultured for 3 days as above before cells were lysed in RIPA buffer (60 μL/well, Merck). Next ...
-
bioRxiv - Bioengineering 2022Quote: ... the wells were rinsed 3 times with PBS and covered with 100 μL 0.5% (v/v) Triton-X 100 (Merck, 1.08603.1000) in PBS for 5 minutes to permeabilize cells ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were reseeded and enriched by selection in their respective media with an added 2.5 µg/ml of puromycin for B16-F1 and 3 µg/ml of puromycin (Merck # p9620) for Rat2 cells ...
-
bioRxiv - Neuroscience 2022Quote: ... slide-mounted OE sections or free-floating OB slices were washed with PBS and incubated in 3 % BSA (Merck, A2153) with 0.25 % triton and 0.02 % sodium azide (Severn Biotech Ltd ...
-
bioRxiv - Microbiology 2022Quote: ... Parasitemias were calculated from day 3 post-infection by counting infected red blood cells in blood smears stained with Hemacolor (Merck).
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... or 300 mM (octamer-mix + APLFAD) ammonium acetate at pH 7.5 using 3 kDa MWCO Amicon Ultra Centrifugal Filter Units (Merck Millipore). After buffer exchange the volume of each sample was ∼40 µL ...
-
bioRxiv - Neuroscience 2022Quote: Tissues or cells were homogenized in Pierce IP Lysis buffer supplemented with protease inhibitor cocktail 3 (Merck Millipore, Darmstadt, Germany) and phosphatase inhibitor PhosSTOP (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... Germany) followed by size-fractionation using a 3 kDa centrifugal filter according to the manufacturer’s instructions (Merck KGaA, Darmstadt, Germany). The samples were kept at 4 °C or on ice throughout the process ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The eluted aliquots were then desalted with filtered water and concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK) to remove any urea and salt residues.
-
bioRxiv - Biochemistry 2022Quote: ... as described by the manufacturer and dried down in a Speed-Vac concentrator (Thermo-Scientific) resuspended in 20 μl L/C water containing 3% acetonitrile (MeCN) (Merck) and 0.1% FA ...