Labshake search
Citations for Merck :
1351 - 1400 of 3922 citations for Mouse Alpha 1 antitrypsin 1 3 SERPINA1C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... rivuli cultures were incubated with 1 mg of chitin suspended in 220 μL 1% PBS (phosphate buffered saline, Sigma Aldrich/Merck, US) in LC-MS grade water ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cancer Biology 2021Quote: Dual-emission potential-sensitive fluorescence dye JC-1 (Merck) was used to measure mitochondrial membrane potential of cells following CAP treatment ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-NuMA1 clone AD6-1 (IF, WB) from Merck Millipore ...
-
bioRxiv - Immunology 2021Quote: ... anti-human Caspase-1 antibody (06-503, Merck Millipore); anti-mouse IL-1β antibody (5129-100 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies for puromycin (1:25,000 dilution; MABE343, Merck), 1:1000 dilution of Esrra (ab16363 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and adding 1 g of haematoxylin (Merck, cat. H9627). After complete dissolution ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-Cux1 (1:100, ABE217; Merck Millipore). Nuclei were stained using Hoechst 33258 (Nacalai Tesque) ...
-
bioRxiv - Cell Biology 2022Quote: ... and probed with antibodies recognizing FAM21 (Merck, 1:1000), WASH (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... TRA-1-60 (Merck Millipore, Germany; Cat. No. MAB4360), and TRA-1-81 (Merck Millipore ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cell extract was treated with 1 µL Benzonase (Merck), supplemented with 0.15% (v/v ...
-
bioRxiv - Biochemistry 2019Quote: An arabinose-inducible pRSFDuet™-1 (Novagen, Merck Millipore) derivative with tetracycline resistance was constructed as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-H3.3 (Merck Millipore 09-838, 1:1000). A peroxidase-conjugated antibody was used to reveal the proteins of interest with the Pierce ECL Western blotting substrate (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2019Quote: ... or anti-dopa decarboxylase (1:500; AB1569; Merck Millipore), followed by 1-h incubation with secondary antibody goat anti-rabbit Alexa Fluor 680 (1:10,000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-phospho Histone H3 (1/500, 06-570, Merck), and anti-ZO-1 (1/50 ...
-
bioRxiv - Physiology 2021Quote: ... anti-Bcrp (1:100 – Bcrp [MAB4146]; Merck Millipore, USA), anti-Abcg1 (1:100 – [PA5-13462] ...
-
bioRxiv - Biochemistry 2020Quote: ... GAPDH (MAB374, diluted 1:5000 for Western Blotting, Merck) and GFP (ab290 ...
-
bioRxiv - Biochemistry 2020Quote: ... mix and 1 μL benzonase (250 units/μL, Merck) for 30 min on ice ...
-
bioRxiv - Biochemistry 2020Quote: ... or actin (MAB1501R, 1:500; Merck-Millipore, Burlington, MA) overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... and rabbit anti-Tbr2 (1:1000, Merck Millipore, AB15894). Species-specific Cy2- ...
-
bioRxiv - Neuroscience 2020Quote: ... 1× cOmplete ULTRA EDTA-free protease inhibitor cocktail (Merck)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 mM PMSF and benzonase (2.5 ku, Merck Millipore) were added and cells were lysed using Emulsiflex (Avestin ...
-
bioRxiv - Cell Biology 2021Quote: ... and goat anti-rat IgG HRP(1:5000; Merck); and goat anti-mouse IgG HRP (1:5000 ...
-
bioRxiv - Systems Biology 2021Quote: ... and 1% penicillin/streptomycin (p/s, Sigma-Aldrich/Merck). For differentiation ...
-
bioRxiv - Plant Biology 2020Quote: ... autoclaved) with 1% β-Mercaptoethanol (Cat No.: M3148, Merck) and 100 μL of Ambion Plant RNA Isolation Aid (Cat No. ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-c-terminal APP (1:1000, rabbit, A8717, Merck), anti-APP/Aβ (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:50 Hyaluronan binding protein HABP (#H0161; Merck, Germany) or 1:100 mouse anti-Neurocan (#N0913 ...
-
bioRxiv - Cell Biology 2021Quote: ... with polyclonal goat anti-ChAT (AB144P; Merck; 1:150) and guinea pig anti-GnRH antibodies (#1018 ...
-
bioRxiv - Cell Biology 2020Quote: ... or NG2 (rabbit, 1:200, AB5320, Millipore-Merck, Sigma) at 4°C overnight in blocking buffer ...
-
bioRxiv - Cell Biology 2020Quote: Anti-CD63 (CBL553, 1:1000) was acquired from Merck.
-
bioRxiv - Cancer Biology 2020Quote: ... using the anti-Puromycin (#MABE343; 1/5000) from Merck Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-GAPDH mab374 at 1/500 dilution (Merck); secondary #15014 at 1/10,000 (Active Motif).
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-MBP (1:300) (#MAB386, Merck-Millipore, Germany). After two washes in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Sigma iPSC0028 (Si28) (EPITHELIAL-1, #IPSC0028, Merck, Darmstadt, Germany) and the transgenic iPSC line Si28-NGN1 ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1% SDS) with 1 × protease inhibitor cocktail (Merck, 04693132001). The cell lysates were centrifuged at 20,000 g for 15 min at 4°C and resuspended in TN buffer (25 mM Tris pH 7.5 ...
-
bioRxiv - Microbiology 2022Quote: ... for the AP or mannan (1 µg/ml) (Merck) for the LP were incubated ON at 4 °C ...
-
bioRxiv - Biophysics 2022Quote: ... 1% penicillin/streptomycin (P0781, Sigma-Merck KGaA, Darmstadt, Germany) and 1 μg/ml Recombinant Human Fibroblast growth Factor-basic (FGFb ...
-
bioRxiv - Neuroscience 2020Quote: Potassium hydroxide (KOH) (1 kg) (Merck cat. no. 1050331000)
-
bioRxiv - Plant Biology 2021Quote: ... and α-rabbit-HRP (A-0545, Merck; 1:10000).
-
bioRxiv - Plant Biology 2021Quote: ... and α-rabbit-HRP (A-0545, Merck; 1:10000). Western blots were imaged with a LAS 4000 IMAGEQUANT SYSTEM (GE Healthcare ...
-
bioRxiv - Neuroscience 2021Quote: ... and laminin (20 µg/ml for 1 hr; Merck) in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Neuroscience 2020Quote: ... KI-67 (1:100; Cat. no. AB9260, Merck Millipore), TUJ1 (1:65 ...
-
bioRxiv - Developmental Biology 2022Quote: ... puromycin antibody was purchased from Merck (MABE343, 1:1000). Alexa Fluor 488-labeled secondary antibody (Invitrogen A21206 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-GluR2 (1:2000, AB1768-I, Merck, Darmstadt, Germany) and anti-β-Actin (1:5000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Trimethylhistone H3 (Lys4) (1:100; Merck Millipore 04-745). Secondary antibodies were Alexa Fluor 488-conjugated donkey anti-goat ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% v/v penicillin/streptomycin (P/S, Merck-SIGMA), 20 ng/ml basic fibroblast growth factor (bFGF ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1% trimethylchlorosilane (TMCS) (Cat. No. B-023; Merck & Co) and 30μL of pyridine (Cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 mg ml-1collagenase IV (Merck Millipore, C4-22) and 70 unit ml-1 DNase (Invitrogen ...