Labshake search
Citations for Merck :
1351 - 1400 of 2733 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Parasitemias were calculated from day 3 post-infection by counting infected red blood cells in blood smears stained with Hemacolor (Merck).
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... or 300 mM (octamer-mix + APLFAD) ammonium acetate at pH 7.5 using 3 kDa MWCO Amicon Ultra Centrifugal Filter Units (Merck Millipore). After buffer exchange the volume of each sample was ∼40 µL ...
-
bioRxiv - Neuroscience 2022Quote: Tissues or cells were homogenized in Pierce IP Lysis buffer supplemented with protease inhibitor cocktail 3 (Merck Millipore, Darmstadt, Germany) and phosphatase inhibitor PhosSTOP (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... Germany) followed by size-fractionation using a 3 kDa centrifugal filter according to the manufacturer’s instructions (Merck KGaA, Darmstadt, Germany). The samples were kept at 4 °C or on ice throughout the process ...
-
bioRxiv - Cell Biology 2023Quote: ... reagent (chlortrimethylsilane [Merck KGaA, Darmstadt, Germany]/1.1.1.3.3.3-Hexamethyldisilasane [Sigma Aldrich, Co., St. Louis, MO, U.S.A]/pyridine [Merck KGaA, Darmstadt, Germany], 9:3:1) in a GC vial for GC-MS-SIM non-cholesterol analysis ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Immunology 2024Quote: ... we included anti-human PD-1 IgG4 S228P antibody (10μg/ml, 1B8/HuPD1B-3, Merck & Co., Inc., Rahway, NJ, USA). For TIM-3 blockade (αTIM-3) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the marine nanofibers were washed three times with 500 μL of ultrapure water using an Amicon Ultra-0.5 Centrifugal Filter Unit (3 kDa cutoff) (Merck Millipore). The collected marine nanofibers were dropped onto a copper grid ...
-
bioRxiv - Microbiology 2024Quote: ... LS-ARS2 overnight culture was inoculated (1% v/v) in MRS broth adjusted to pH 4 and pH 3 with HCl (1N, Merck), followed by incubation for 0 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purification of the labelled proteins was done by repeated filtration in a 3 kDa filter (Amicon Ultra-15 Centrifugal Filter Unit, Merck).
-
bioRxiv - Neuroscience 2024Quote: ... Slices were then washed in PBS and incubated in 0.2% Sudan black in 70% ethanol at room temperature for 3 minutes to minimize autofluorescence and mounted on glass slides (Menzel-Gläser) with FluorSave (Merck Millipore).
-
bioRxiv - Neuroscience 2024Quote: ... After washing 3 times for 10 minutes with PBS, slices were mounted on glass slides (J2800AMNZ, Epredia) with FluorSave (345789, Merck).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Zn and Mn extraction from earthworm tissue was performed using Teflon vessels and 7 mL of reverse aqua regia (3:1 ratio of HCl:HNO3; Merck, Darmstadt) on hot plates in an open system ...
-
bioRxiv - Physiology 2024Quote: ... followed by 7 days treatment with primary antibodies diluted 1:10,000 in 100 ml immunostaining buffer (3% horse serum, 10% CHAPS (Merck, 220201), 2% Triton X-100 ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Biochemistry 2024Quote: ... HPLC-grade trichloroacetic acid (TCA) and difluoroacetic acid (DFA) were purchased from Merck and Sigma-Aldrich (Munich ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: The samples were incubated in permeabilization solution (0.2% Triton X-100, 0.3 M glycine (Merck, #G5417), 20% DMSO (Corning ...
-
bioRxiv - Cell Biology 2020Quote: ... pDEST15 plasmids were transformed in Rosetta™ 2(DE3)pLysS Competent bacteria (Merck Millipore). Bacteria cultures were grown with the proper antibiotic at 37°C until an OD of 0.6 was obtained ...
-
bioRxiv - Microbiology 2021Quote: ... Freeze substitution was done in dry acetone containing 2% osmium tetroxide (Merck, Darmstadt, Germany) and 2% water with an AFS (Leica microsystems ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was loaded on a 2 ml HIS-SelectTM Nickel Affinity Gel (Merck) and washed with wash buffer ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was loaded on a 2 ml HIS-SelectTM Nickel Affinity Gel (Merck) and washed with wash buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... concentrated using 100 kDa-MWCO Centricon plus-20 and Centricon plus-2 (Merck-Millipore), aliquoted and stored at -80 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mM EDTA and 200 μg/ml PMSF) supplemented with protease inhibitors (Merck Chemicals) and centrifuged at 800x g for 10 min at 4°C to result in P1 and supernatant S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Anti-human Aβ mouse monoclonal antibody (clone W0-2; Merck Chemicals GmbH, Darmstadt, Germany) and rabbit anti-β-actin monoclonal antibody (clone 13E5 ...
-
bioRxiv - Neuroscience 2021Quote: ... and lysed directly in 15 µl 2x Laemmli buffer containing 10% 2-mercaptoethanol (Merck). Samples were loaded on a 4-to-20% SDS polyacrylamide gel (Bio-Rad) ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (#D9542, Merck. Darmstadt. Germany).
-
bioRxiv - Cell Biology 2021Quote: ... Differentiation of 4D7 and 2M12 cells was induced by 2% dimethyl sulfoxide (DMSO; Merck) for 48 hr ...
-
bioRxiv - Cell Biology 2021Quote: ... and after 24 h the transformants were selected with 2 μg/mL puromycin (Merck) for 24–48h.
-
bioRxiv - Developmental Biology 2022Quote: ... (2) we added 50 µg/mL (0.28 collagenase Wünsch units) of Liberase TM (Merck) in the digestion solution ...
-
bioRxiv - Physiology 2022Quote: ... cultures were fixed with 4% PFA and stained with 2% Alizarin red S (Merck). For the quantification ...
-
bioRxiv - Developmental Biology 2020Quote: ... mice were injected intraperitoneally with a filter sterilized solution of 2 mg doxycycline (Merck), dissolved in PBS (100 μl or 200 μl of a filter sterilized ...
-
bioRxiv - Microbiology 2021Quote: ... in 2 ml tubes containing 0.3 mm diameter glass beads (Merck KGaA, Darmstadt, Germany). The mixture was vortexed ...
-
bioRxiv - Biochemistry 2021Quote: Transformation of Escherichia coli strain BL21(DE3) Rosetta-2 pLysS (Novagen Merck, Darmstadt Germany) were made with a pET3d-His6-CrFBA3 plasmid ...
-
bioRxiv - Physiology 2021Quote: ... a grid was briefly placed on 10 μL 2% uranyl acetate (w/v, Merck). Images were acquired under a JEM-1010 electron microscope (JEOL ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was done using 2 ng of DNA and KOD hot star (MercK). PCR fragments were sequenced by EurofinsGenomics ...
-
bioRxiv - Biochemistry 2023Quote: ... 100mM NaCl using 3k cut-off Amicon® Ultra 2 mL Centrifugal Filters (Merck). Equal amounts of protein from both dialyzed and undialyzed samples were treated with caspase-3 as described above ...
-
bioRxiv - Plant Biology 2023Quote: ... then 2% w/v Aspegillus niger pectinase (Merck Life Science UK Ltd., Gillingham, UK) 45°C for 2 hours ...
-
bioRxiv - Biophysics 2023Quote: Snap-Streptavidin-WA-His (pETplasmid) was expressed in Rosetta 2 (DE3) pLysS (Merck, 71403). Culture was grown in TB medium supplemented with 30 µg/ml kanamycin and 34 µg/ml chloramphenicol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The eluted samples were concentrated using an Amicon Ultra-2 centrifuge filter unit (Merck) and stored on ice.
-
bioRxiv - Molecular Biology 2023Quote: ... CaCo-2 cell lines were cultivated in Minimum Essential Medium Eagle (MEM) (Merck, M4655) complemented with 20% FBS Tetracycline free ...
-
bioRxiv - Developmental Biology 2023Quote: ... except for a different set of SYBR green primers (Sigma Merck, Supplementary Table 2). The obtained Ct values were analyzed using the ddCt method for relative quantification of mRNA expression derived from three independent experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... concentrated using 100 kDa-MWCO Centricon plus-20 and Centricon plus-2 (Merck-Millipore), aliquoted and stored at -80°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% streptomycin and 2 mM of Glutamax and 0.1 μg·ml−1 GDNF (#SRP3200, Merck) (Vyas et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by 2 layers of SCX strong cation exchange Empore™ SPE Disks (Merck). Samples were then lyophilized.
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Cell Biology 2022Quote: Snap-Streptavidin-WA-His (pETplasmid) was expressed in Rosettas 2 (DE3) pLysS (Merck, 71403). Culture was grown in TB medium supplemented with 30 μg/mL kanamycine and 34 μg/mL chloramphenicol ...
-
bioRxiv - Cell Biology 2022Quote: ... Mission siRNA for human Pacsin 2 siRNA (SASI_Hs01_0021-5538, SASI_Hs01_0021-5539 and SASI_Hs01_0021-5540, Merck) or MISSION siRNA Universal Negative Control #1 (SIC-001 ...