Labshake search
Citations for Merck :
1251 - 1300 of 1763 citations for Progesterone Metabolites ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and bacterial pellets were resuspended in 5 ml of cold column buffer with 1x PIC (Protease inhibitor cocktail set I; Cat. Nr. 539131-10VL, Merck) and 200 mM PMSF (Cat ...
-
bioRxiv - Bioengineering 2019Quote: Fixed samples were centrifuged at 1,957 x g for 5 min at room temperature and re-suspended in cold Milli-Q water (Merck-Millipore) (4°C) ...
-
bioRxiv - Physiology 2021Quote: ... with 0.2 % m/v Triton-X100 and 5% Normal Goat Serum (m/v) (S26-LITER, Merck Life Science UK LTD) (PBST.NGS ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Cell Biology 2021Quote: ... HL-60 and MS-5 cells cultured alone and in co-culture were incubated for 24 hours in 50 μM H2O2 (Merck) complete cell culture medium ...
-
bioRxiv - Plant Biology 2021Quote: ... (+/-)-Abscisic acid (ABA, CAS No:14375-45-2), and Gibberellic acid (GA3, CAS No: 77-06-5) were purchased from Merck KGaA/ Sigma-Aldrich (Darmstadt ...
-
bioRxiv - Neuroscience 2020Quote: ... two custom-made Teflon containers of 5 mm diameter were filled with 10 μl of odor substance (n-amylacetate, AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Microbiology 2021Quote: ... chromatographic separation was performed on ZIC-pHILIC column equipped with a guard (5 µm, 4.6 × 150 mm, SeQuant®, Merck). The mobile phase (A ...
-
bioRxiv - Biophysics 2020Quote: ... 50 μL of sample was injected onto a Discovery BIO Wide Pore C18 column (15 cm x 4.6 mm, 5 μm column with a guard column) (Supelco, Merck, UK) and eluted on a gradient of 95% water + 0.1% acetic acid and 5% acetonitrile + 0.1% acetic acid to 5% water + 0.1% acetic acid and 95% acetonitrile + 0.1% acetic acid at a 0.8 mL/min flow-rate over 40 mins ...
-
miR-206 inhibits estrogen-induced proliferation and invasion of ER-α36 positive gastric cancer cellsbioRxiv - Cancer Biology 2021Quote: ... 20 μL of the MTT solution was added to each well (5 mg/ml, Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Then ...
-
bioRxiv - Cell Biology 2021Quote: ... against a final buffer (20mM Hepes, 200 mM NaCl, 5% Glicerol, 2mM DTT) and concentrated with appropriate MW cut-off Vivaspin columns (Merck). The concentration of purified proteins was determined by colorimetric assay (Bio-Rad DC Protein Assay ...
-
bioRxiv - Cell Biology 2021Quote: ... Spleen cells isolated from the mouse with the best serum titre were fused with Sp2/0 cells in the ratio of 5:1 using polyethylene glycol (PEG) 3000 (#817019, Merck). 10 million cells of the fusion mix were combined with 2x 104 BALB/c peritoneal macrophages and seeded in a 96-well plate ...
-
bioRxiv - Cell Biology 2021Quote: The samples were loaded onto a 5–20% gradient SDS-PAGE gel (Wako, Osaka, Japan) and transferred to an Immobilon-P Transfer Membrane (Merck). Antibodies were diluted with Signal Enhancer HIKARI for Western Blotting and ELISA (Nacalai Tesque) ...
-
bioRxiv - Microbiology 2022Quote: ... Separation in the HPLC was carried out using a SeQuant ZIC-pHILIC column (PEEK 150 × 2,1 mm, 5 μm, 110 Å, Merck) at 30 °C with an CH3CN (buffer A ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: HEK293T cells were cultured in 10 cm tissue culture treated dishes grown at 37 °C in a 5% CO2 atmosphere in HEPES buffered DMEM/F12 1:1 (Merck) supplemented with 10% fetal bovine serum and 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...
-
bioRxiv - Neuroscience 2020Quote: Cell-cycle kinetic differences were assessed by labelling cortical progenitor cells using a nucleotide analog 5-ethynyl-2’-deoxyuridine (EdU; Merck) in vivo following 150 □g EdU injection into the peritoneal cavity of pregnant mice 1 hour before the sacrifice of the embryos ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were incubated for 72h with the indicated concentrations of the respective drugs and further incubated for 3h with 5 mg/ml MTT (Merck). Finally ...
-
bioRxiv - Pathology 2019Quote: ... For MALDI-TOF/TOF/MS analysis dried peptides were dissolved in peptide resuspension solution (0.1% TFA in 5% ACN) and desalted/concentrated using C18 zip tips (Merck Millipore) as per the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Nuclei were pelleted by centrifugation at 3000 rpm for 5 min at 4°C and were resuspended in hypotonic buffer containing 1U/µl of benzonase (Merck). Extracts were incubated on ice for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... Chromatographic separation was achieved using a silica-based SeQuant ZIC-pHILIC column (2.1 mm × 150 mm, 5 µm, Merck, Germany) with elution buffers consisting of (A ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were blocked using 5% non-fat dry milk in Tris-buffered saline with 0.1% Tween 20 (655204, Merck Millipore) and probed with the respective primary and secondary antibodies ...
-
bioRxiv - Developmental Biology 2020Quote: ... pregnant mice were injected intraperitoneally with 375 μg doxycycline (75 μl of a filter sterilized, 5 mg/ml solution of Doxycycline Hyclate (Merck) dissolved in PBS) ...
-
bioRxiv - Microbiology 2021Quote: ... The separation in the HPLC was carried out using a SeQuant ZIC-pHILIC column (PEEK 150 × 2.1 mm, 5 μm, 110 Å, Merck) at 30°C with an CH3CN (buffer A ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were stored at 4°C overnight before desilicification with 4% suprapure hydrofluoric acid (Merck; incubation of approximately 5 hours). Afterwards ...
-
bioRxiv - Microbiology 2021Quote: ... The sonicated cellular extract was spun down and the supernatant has been incubated with His-binding resin (Merck 69670-5) for 10-30 min at room temperature ...
-
Revisiting a GWAS peak in Arabidopsis thaliana reveals possible confounding by genetic heterogeneitybioRxiv - Genetics 2021Quote: ... 2 µl of each sample was injected into a SeQuant ZIC-pHILIC HPLC column (Merck, 100 × 2.1 mm; 5 µm), and the respective guard column operated with an Ultimate 3000 HPLC system (Dionex ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... supernatants containing RBD or soluble Spike were concentrated and diafiltrated against 20 mM sodium phosphate buffer containing 500 mM NaCl and 20 mM imidazole (pH 7.4) using a Labscale TFF system equipped with a 5 kDa cut-off Pellicon XL device (Merck Millipore). The His-tagged proteins were captured using a 5 mL HisTrap FF crude column connected to an ÄKTA pure chromatography system (both from Cytiva ...
-
bioRxiv - Microbiology 2019Quote: ... samples were fixed in 2.5% (v/v) glutaraldehyde in HBSS on IsoporeTM membrane TMTP filters with pore size 5 µm (Merck-Millipore) for 30 min followed by washing thrice with HBSS buffer (10 min each) ...
-
bioRxiv - Cell Biology 2021Quote: ... LECs (1.5 × 105) were transfected with 25 pmol of target siRNA or non-target siRNA (MISSION siRNA universal control#1, Merck) using Lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Bioengineering 2022Quote: ... samples were blocked and permeabilized with 2% BSA and 0.1% Triton X-100 (#9036-19-5, Sigma-Aldrich now Merck) in PBS for 30 minutes at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 mM MgCl2 buffer at a final concentration of 5 mg/mL using three consecutive cycles of freezing in liquid nitrogen and thawing in an ultrasonic bath (Merck). The rehydrated lipid solutions were extruded 21 times through a 100 nm diameter pore size polycarbonate membrane (Avanti Polar Lipids Inc.) ...
-
bioRxiv - Biochemistry 2022Quote: ... The resulting cell pellet was freeze-thawed thrice and re-suspended to 10% (w/v) in a lysis buffer containing 5% (v/v) Polysorbate 80 and 20 U/mL benzonase (Merck). After 1h incubation at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... the sections were treated with 10% methanol in PB for 20 min and then incubated for 1 h at RT in incubation buffer: 5% normal donkey serum (NDS: Merck) and 0.2% Triton X-100 (Merck ...
-
bioRxiv - Physiology 2022Quote: ... They were then permeabilized with 0.02% Triton X-100 in PBS for 15 min and blocked with 5% bovine serum albumin (Sigma-Aldrich, Merck) in PBS for 3 h ...
-
bioRxiv - Microbiology 2022Quote: ... fixed with cold methanol for 5 min and permeabilized with PBS containing 0.1% Triton X-100 (Merck Life Science, T8787). For the staining of acidic organelles ...
-
bioRxiv - Microbiology 2022Quote: ... cells were cultured in 25 cm2 flasks at 37°C and 5% CO2 using advanced Dulbeccos modified Eagle medium (DMEM; TFS) with the addition of 10% fetal bovine serum (Merck), 50 U/mL penicillin and 50 μg/mL streptomycin (TFS) ...
-
bioRxiv - Neuroscience 2022Quote: ... Cubes of 1 cm3 were cut and incubated overnight in an aqueous solution of 150 mM NaCl (S9888, CAS 7647-14-5, Merck) and 10 µM fluorescein (46955 ...
-
Neuron-astrocyte metabolic coupling facilitates spinal plasticity and maintenance of persistent painbioRxiv - Neuroscience 2022Quote: ... the sections were equilibrated to room temperature and then washed twice for 5 minutes (min) in PBST (0.1% Triton X-100 (Merck, #108603)/PBS) ...
-
bioRxiv - Immunology 2023Quote: ... peptides were dissolved at a concentration of 1 to 5 mg ml-1 in 1x PBS and incubated with TCEP agarose CL4-B (Merck) for 1 hour to reduce paired cysteines ...
-
bioRxiv - Plant Biology 2023Quote: ... Sheared chromatin was incubated with 10 µg of α-H4.V or 5 µg of α-H4K5Ac (Merck 07-327) or 4 µg of α-H4 (Abcam ab10158 ...
-
bioRxiv - Immunology 2023Quote: ... Titers were determined by transduction of Jurkat cells (ACC 282; DSMZ) in presence of 5 µg/ml Polybrene Infection/Transfection Reagent (Merck). After 48 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The interlocking ring included a central odorant delivery platform (Additional File 1C) comprising a 10-mm-diameter cover glass and two 5-mm-diameter filter discs (WHA10016508; Merck) for the evaluation of VOCs that interact with or blend with human odor (stl files are provided in additional files 2 and 3) ...
-
bioRxiv - Biochemistry 2023Quote: ... membranes were blocked with 5% BSA in TSMT (20 mM Tris; 150 mM NaCl, Merck; 1 mM CaCl2, Sigma; 2 mM MgCl2, Merck; adjusted to pH 7 with HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... equipped with a LiChrospher® 100 RP-18 (125 mm x 4 mm, 5 µm) C18 reversed-phase column (Merck). The elution solvents consisted of ultrapure water with 0.1% formic acid (A ...
-
bioRxiv - Immunology 2023Quote: ... were transduced with respective CORA receptors in a multiplicities of infections (MOI) of 1 and 5 μg/mL Polybrene (Merck). Cells harboring the receptor were enriched by using biotinylated anti-EGFR antibody and anti-biotin microbeads (Miltenyi Biotec).
-
bioRxiv - Immunology 2023Quote: CORA receptors were transduced into a previously described Jurkat-based reporter cell line (12) by addition of lentiviral particles in a MOI of 1 and 5 μg/mL Polybrene (Merck) using spinoculation ...
-
bioRxiv - Pathology 2023Quote: ... Then sections were blocked for 45 min using a blocking buffer containing 5% goat or donkey serum (depending on the host species of the secondary antibody) (#G9023 and #D9663, Merck) and 0.3M glycine (#56-40-6 ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).