Labshake search
Citations for Merck :
1151 - 1200 of 1657 citations for Potassium 3 4 difluorophenyl trifluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and the peak fractions were pooled and concentrated using a 3 kDa molecular weight cut off (MWCO) spin concentrator (Merck). The concentration of the protein was measured via Bradford assay against a bovine serum albumin (BSA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purification of the labelled proteins was done by repeated filtration in a 3 kDa filter (Amicon Ultra-15 Centrifugal Filter Unit, Merck).
-
bioRxiv - Molecular Biology 2024Quote: ... cell pellets were resuspended in 500 μL Nuclear RNA lysis buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 1% BSA (Merck, #B9000S), 0.1% Tween (Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... we included anti-human PD-1 IgG4 S228P antibody (10μg/ml, 1B8/HuPD1B-3, Merck & Co., Inc., Rahway, NJ, USA). For TIM-3 blockade (αTIM-3) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then 500 μL Nuclear RNA wash buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 1% BSA (Merck, #B9000S), 0.1% Tween (Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were then washed in PBS and incubated in 0.2% Sudan black in 70% ethanol at room temperature for 3 minutes to minimize autofluorescence and mounted on glass slides (Menzel-Gläser) with FluorSave (Merck Millipore).
-
bioRxiv - Neuroscience 2024Quote: ... After washing 3 times for 10 minutes with PBS, slices were mounted on glass slides (J2800AMNZ, Epredia) with FluorSave (345789, Merck).
-
bioRxiv - Immunology 2024Quote: Human monocytes were plated at 2 × 105 cells/well in 96 well plates and cultured for 2-3 days in RPMI supplemented with 10% human serum (from human male AB plasma, Merck), 1 U/mL penicillin and 0.1 mg/mL streptomycin ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Neuroscience 2024Quote: ... or (2) collected 3 days after transfection and enriched by filter device (Amicon Ultra-15 Centrifuge Filters, Merck, Cat#UFC910008). Viral pellets were resuspended in sterile PBS ...
-
bioRxiv - Physiology 2024Quote: ... followed by 7 days treatment with primary antibodies diluted 1:10,000 in 100 ml immunostaining buffer (3% horse serum, 10% CHAPS (Merck, 220201), 2% Triton X-100 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Zn and Mn extraction from earthworm tissue was performed using Teflon vessels and 7 mL of reverse aqua regia (3:1 ratio of HCl:HNO3; Merck, Darmstadt) on hot plates in an open system ...
-
bioRxiv - Molecular Biology 2024Quote: ... the marine nanofibers were washed three times with 500 μL of ultrapure water using an Amicon Ultra-0.5 Centrifugal Filter Unit (3 kDa cutoff) (Merck Millipore). The collected marine nanofibers were dropped onto a copper grid ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Molecular Biology 2021Quote: ... Slices were then stored at 4°C in a PBS-solution containing 0.05% of Proclin (Merck, Darmstadt, Germany) until further processing.
-
bioRxiv - Biophysics 2020Quote: ... Eluted fractions containing monomeric H57-scFV were concentrated with 10 kDa Amicon® Ultra-4 centrifugal filters (MERCK), treated with a 3C protease (71493 ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.2 buffer were concentrated to 10 mg/ml using the Amicon Ultra-4 Centrifugal Filter Unit (Merck/Millipore ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Bruce-4 cell line was maintained in DMEM supplemented with 15% FCS and ESGRO (Merck Millipore, UK) on a 0.1% gelatine-coated dish at 10% CO2.
-
bioRxiv - Molecular Biology 2021Quote: ... treated with PBS-formaldehyde (4%) for 20 mins at room temperature and stained with crystal violet stain (Merck). After extensive washing ...
-
bioRxiv - Pathology 2022Quote: ... trans-cardial perfusion was performed into the mice and rats with PBS followed by 4% paraformaldehyde (PFA, Merck). The kidneys were harvested and the samples were post-fixed in 4% PFA at 4°C for 90 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Sliced sections were permeabilized and blocked with 0.1% Tween-20 and 4% donkey serum (Merck Millipore, Burlington, MA) in Tris-buffered saline ...
-
bioRxiv - Cell Biology 2022Quote: ... coli cells using 0.2 mM IPTG for 4 hours at 30 °C and purified on flag beads (Merck) and eluted using flag peptide buffer (200 µg/ml flag peptide in 10 mM Tris-HCL ...
-
bioRxiv - Cell Biology 2022Quote: ... lysates were incubated overnight under rotation at 4°C with ANTI-FLAG® M2 Affinity Gel beads (Merck) to pull down FLAG-containing SNAP-GLP-1R ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein wet transfer was performed overnight at 4°C using an Immobilon®-FL PVDF membrane (Merck™). Next day ...
-
bioRxiv - Biochemistry 2021Quote: ... were incubated overnight at 4°C with rotation with 20 µg/ml anti-FLAG M2 antibody (Merck, F3165) and 50 µl/ml of pre-washed Pierce magnetic protein A/G beads (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Protein was concentrated to 1 ml using a Amicon Ultra-4 Ultracel 30 kDa spin concentrator (Merck Millipore) and the protein was separated on a HiPrep 16/60 Sephacryl S-200 HR column (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL lipid extract was injected on a LiChroCART 250–4 LiChrospher® Si 60 (5 μm) (Merck) maintained at 25 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were fixed with 4% paraformaldehyde for 30 min and stained with 1% crystal violet (Merck, Darmstadt, Germany) for 20 min at RT ...
-
bioRxiv - Immunology 2020Quote: ... fixed with paraformaldehyde (4% w/v (Applichem) in phosphate-buffered solution (PBS)) and used for Giemsa-staining (Merck) to calculate the number of perivascular neutrophils ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated overnight at 4°C with monoclonal anti-NeuN antibody (1:500; Mouse, MAB377, Merck Millipore), in a 50% dilution of blocking buffer + 0.5% Triton X-100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysates were harvested in 4°C RIPA buffer with protease inhibitor (cOmplete, EDTAfree Protease Inhibitor Cocktail, Merck) and homogenised by sonication for 30 sec ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% Triton X-100) and 20μg was immunoprecipitated overnight at 4°C with 10μg S9.6 antibody (Merck, MABE1095) conjugated to 100μL Pierce ChIP-grade protein-A/G magnetic beads (Thermo ...
-
bioRxiv - Immunology 2021Quote: ... Frozen tissues were sectioned to a thickness of 5 μm and fixed with 4% paraformaldehyde (Merck, Kenilworth, NJ). Slides were incubated with 1% BSA in PBST for 1 h to block the non-specific antibody binding ...
-
bioRxiv - Cell Biology 2022Quote: E10.5 embryos were fixed in 4% PFA/PBS for 1.5 h followed by incubation in 15% sucrose (Merck)/PBS for 2 h and overnight incubation in 30% sucrose/PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... CMCs were incubated at room temperature for 4 hours with rhodamine-labeled phalloidin (1:100, Merck Life Science) and/or Alexa-Fluor-488 ...
-
bioRxiv - Molecular Biology 2022Quote: ... sections were incubated at room temperature for 4 hours with rhodamine-labeled phalloidin (1:100, Merck Life Science) and/or Alexa-Fluor-488 or -568-conjugated IgG secondary antibodies (1:500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Swi2C-Swi5 complex was concentrated using an Amicon Ultra-4 (30 k) centrifugal filter (UFC803008, Merck Millipore). After cleavage ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Swi2CS-Swi5 complex was concentrated using an Amicon Ultra-4 (10 k) centrifugal filter (UFC801008, Merck Millipore).
-
bioRxiv - Molecular Biology 2022Quote: ... The Swi2S-Swi5 complex was concentrated using an Amicon Ultra-4 (50 k) centrifugal filter (UFC805008, Merck Millipore), applied to a 5 mL HiTrap Heparin column ...
-
bioRxiv - Cell Biology 2022Quote: ... and concentrated at 4 °C approximately 300 times using a 10 kDa Centricon Plus-70 centrifugal unit (Merck Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... Choline acetyltransferase (ChAT) expression was detected with a goat polyclonal antibody (1:500; 4°C overnight, AB144p, Merck) and revealed with the secondary antibody Alexa Fluor 647 donkey anti-goat IgG (1:500 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: HepaRG cells were washed twice with 100 μl PBS pH 7.4 and fixed with paraformaldehyde solution (4% in PBS pH 7.4, Merck) for 40 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Products were separated on a LiChroCART 125-4 RP-18 end-capped 5 µm column (Merck, Darmstadt, Germany) with a solvent system of methanol and phosphoric acid (0.1% ...
-
bioRxiv - Immunology 2023Quote: ... Fractions containing monomeric and labeled 14.4.4 scFVs were concentrated with Amicon Ultra-4 centrifugal filters (10 kDa cut off, Merck) to arrive at a protein concentration between 0.2 mg ml-1 and 1 mg ml-1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled according to purity and afterwards concentrated using Amicon Ultra-4 centrifuge filters (30 kDa cutoff, Merck Millipore). The purified octamers were validated by SDS-PAGE ...
-
bioRxiv - Biophysics 2023Quote: ... Peak fractions were pooled and concentrated in an Amicon Ultra-4 Ultracell 30kDa centrifugal filter (Merck-Millipore #UFC803024). Aliquots were snap frozen and stored at −80 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Peak fractions were pooled and concentrated in an Amicon Ultra-4 Ultracell 30kDa centrifugal filter (Merck-Millipore #UFC803024). Aliquots were snap frozen and stored at −80°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and then protein was loaded into Superdex 200 and concentrated using Amicon Ultra-4 (3K cut off, Merck). The labeling percentage was calculated according to the manufacturer’s protocol ...