Labshake search
Citations for Merck :
1101 - 1150 of 4702 citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... The samples were digested in a closed-vessel microwave system (MarsExpress; CEM Corp; Matthews, NC, USA) in 2 ml of 30% (v/v) premium-grade H2O2 (Merck, EMSURE®, Darmstadt, Germany) and 5 ml of 65% (v/v ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 50 µL benzaldehyde (BA) and 250 µL 3-octanol (OCT) (CAS 100-52-7, and 589-98-0, respectively; Merck, Darmstadt, Germany) were applied undiluted to 1-cm-deep Teflon containers of 5 and 14 mm diameter ...
-
bioRxiv - Biochemistry 2020Quote: ... Anti-HA (Merck, HA-7), Anti phospho-histone H2AX (2577 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The formazan crystals were dissolved using 200 µl dimethyl sulfoxide (DMSO; Merck, Burlington, USA) and absorbance was measured at 520 nm (Biorad ...
-
bioRxiv - Plant Biology 2024Quote: ... samples were acidified to pH 2 with formic acid and desalted with pipette tips packed with six layers of C18 Empore™ SPE Disks (Merck, cat. no.66883-U) and dried in a Speed Vac at 45 °C for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3-NT (1:1000, 06-284, Merck) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3-NT (1:1000; 06-284, Merck). Following primary antibody incubation ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... Quantification of viable cells was performed by staining with 7-aminoactinomycin D (7-AAD; Merck) and flow cytometry or with crystal violet staining with colorimetric detection.
-
bioRxiv - Microbiology 2023Quote: ... containing solid (7 g L−1 agar) full-strength Hoagland (2.75 mL well−1; pH adjusted to 6.5) (Sigma-Aldrich, Merck), sealed with parafilm and placed under the growth chamber ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were counted and frozen in freezing medium (DMEM containing 10% dimethyl sulfoxide (DMSO; Merck), and 20% FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... CCh stocks were aliquoted in dimethyl sulfoxide (DMSO; Final Concentration: 0.01 %) (Merck KGaA, Darmstadt, Germany) whereas DHPG and KA were aliquoted in distilled water.
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... dissolved in DSMO (Dimethyl Sulfoxide suitable for HPLC, ≥99.7%, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) based on Moriarty [37] ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... at 10 000 μg/mL in dimethyl sulfoxide (DMSO, Merck KGaA, Saint-Quentin-Fallavier, France) was thawed from the freezer at -80°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Potassium chloride (Merck, 7447-40-7), Sodium chloride (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Microbiology 2021Quote: Cell viability and cytotoxicity of antibiotics and peptides were determined against human corneal epithelial cells (HCE-2, CRL-11135, ATCC, Manassas, Virginia, USA) using cell-counting-kit-8 (CCK-8) assay (Sigma Aldrich, Merck Life Science UK Limited, Dorset, UK) and lactate dehydrogenase (LDH ...
-
bioRxiv - Cancer Biology 2024Quote: ... twice with PBS and then pre-coupled tumbling at 4°C for 2 h with antibodies anti-p53 PAb1620 (Merck-Millipore, 0.2 µg/15 µl beads/IP), anti-p53 PAb240 (Merck-Calbiochem ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Neuroscience 2023Quote: ... with a stock solution of gramicidin A (4 mg/ml - dissolved in dimethyl sulfoxide, DMSO, Merck) to achieve a final concentration of 80 μg/mL gramicidin19 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2020Quote: 22) Glucose (Merck, CAS #14431-43-7)
-
bioRxiv - Physiology 2024Quote: ... U73122 was from Merck (112648-68-7) and eserine from MedChemExpress (HY-N6608) ...
-
bioRxiv - Cell Biology 2023Quote: ... 7 U/ml creatine phosphokinase (Merck, C3755)) as well as an oxygen scavenger system (0.2 mg/ml catalase (Merck ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was isolated using 1-bromo-3-chloropropane (Merck) and the Analytik Jena Kit (#845-KS-2040050) ...
-
bioRxiv - Immunology 2021Quote: ... the collected PBMCs were resuspended in freezing medium consisting of 10% (v/v) dimethyl sulfoxide (DMSO; Merck) and 90% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... ∼5,000 previously anti-dinitrophenyl (DNP) IgE-sensitized lung MCs (overnight at 1 µg/ml, clone SPE-7, Merck) were washed in Tyrode buffer (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... pH 7) supplemented with a defined volume of Overnight Express Autoinduction System 1 solution (Merck KGaA, Darmstadt, Germany). Cultures were incubated in baffled flasks at 37°C and 200 rpm overnight ...
-
bioRxiv - Immunology 2020Quote: Bafilomycin A (HY-100558, MCE, Monmouth Junction, NJ, USA) was diluted in dimethyl sulfoxide (DMSO, Sigma-Aldrich, Merck) to 100 μM stock solution and diluted to a 20 nM working solution ...
-
bioRxiv - Pathology 2023Quote: ... and then placed in a freeze protective solution (dimethyl sulfoxide in 125 mM PB with 20% glycerol, Merck Life Science AS/Sigma Aldrich Norway AS ...
-
bioRxiv - Neuroscience 2023Quote: ... and then placed in a freeze protective solution (dimethyl sulfoxide in 125 mM PB with 20% glycerol, Merck Life Science AS/Sigma Aldrich Norway AS ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µM Carbonyl cyanide 3-chlorophenylhydrazone (CCCP; Merck, Cat. #C2759, Germany), 1 µM rotenone (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.48 mM MgSO4 x 7 H2O (Merck, 1058860500), 1.2 mM KCl (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... anti-HA (HA-7, H3663, lot 066M4837V, Merck) 1/1,000 ...
-
bioRxiv - Neuroscience 2022Quote: D-(+)-Glucose (G8270, CAS 50-99-7, Merck) in Perfusion Fluid CNS was used to prepare nanoESI-FTMS calibration samples ...
-
bioRxiv - Microbiology 2022Quote: ... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... anti-HA (HA-7, H3663, lot 066M4837V, Merck) 1/1,000 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 100 mM KCl (7447-40-7, Merck, DE), 10 mM MgCl2 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.