Labshake search
Citations for Merck :
1101 - 1150 of 5379 citations for 6 propan 2 yl 1 3 5 triazine 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... iPSC-derived mesodermal cells were fed with basal medium supplemented with 4 μM IWR-1 (Merck) for 48 h ...
-
bioRxiv - Neuroscience 2021Quote: ... or Cy5-conjugated secondary antibodies (1:200; AP192SA6; Merck Millipore, USA; 17 hrs at 4°C). Similar immunolabeling steps were followed for the subsequent sequential staining ...
-
bioRxiv - Immunology 2020Quote: ... BJ-5at fibroblasts were kept in a 4:1 mixture of the Dulbecco’s Medium (Merck, #D6429) and Medium 199 (Gibco ...
-
bioRxiv - Neuroscience 2021Quote: ... brains were quickly removed from the skull and snap frozen at −25°C in isopentane (2-Methylbutane, Merck Life Science, Italy). Once frozen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Organoid cells were cultured in self-renewing medium with ROCKi for 8 days before Dox (Doxycycline hyclate, 2 µg/ml, Merck, D9891) and TMP (Trimethoprim ...
-
Trypanosoma brucei J protein 2 functionally cooperates with the cytosolic Hsp70.4 and Hsp70 proteinsbioRxiv - Molecular Biology 2019Quote: ... 2 mM MgCl2) or into the appropriate assay buffer for functional studies and then subsequently concentrated against PEG 20000 (Merck, Germany). The protein yield was estimated using the Bradford assay (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2019Quote: ... Pelet was dissolved in 2 ml DDW and passed through a 0.2-μm membrane filter (Millex-GV Filter Unit, Merck Millipore, Ireland). The filtrate was used for sucrose ...
-
bioRxiv - Neuroscience 2020Quote: ... a buffer suitable to investigate aggregates resistance to digestion (detailed below) and 2) the SysQuant Buffer (8M urea, phosphatase inhibitor (PhosSTOP™, Merck) and protease inhibitor (cOmplete™ ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... PAb directed against phospho-STAT2 (Tyr689) and MAb directed against human IFNα/β receptor chain 2 (MAB1155) were purchased from Merck-Millipore.
-
bioRxiv - Bioengineering 2021Quote: Unbound DNA was removed from DNA-SWCNT samples prepared by direct sonication and MeOH-assisted surfactant exchange by rinsing with Amicon centrifugal ultra-filtration devices (Amicon Ultra-2, Sigma Aldrich, 100 kDa membrane, Merck), as detailed above ...
-
bioRxiv - Bioengineering 2021Quote: ... and GEES protein fractions (2-16 µg) were processed by the MED-FASP protocol using Microcon 30k centrifugal ultrafiltration units (Merck, Darmstadt) [11] ...
-
bioRxiv - Biochemistry 2020Quote: ... Next the medium was replaced with a serum-free media supplemented with 2 nM brain-derived neurotrophic factor (BDNF) (Merck Millipore). After 2 days in the BDNF-containing media ...
-
bioRxiv - Neuroscience 2020Quote: The barrier integrity of the in vitro BBB models was assessed through measurements of TEER using Millicell ERS-2 epithelial volt-ohm Meter and STX01 Chopstick Electrodes (Merck Millipore). The TEER value for each hanging culture insert was obtained from an average of three individual measurements subtracted the TEER value of a double-coated cell-free hanging culture insert and multiplied by the area of the hanging culture insert (1.12cm2) ...
-
bioRxiv - Plant Biology 2022Quote: CGMMV vsiRNAs were quantified by RT-qPCR according to Shi and Chiang (2005) with some modifications: 2 μg of RNA extracts from the cucumber leaves were treated with DNaseI (Merck, Spain) and polyadenylated using the Poly(A ...
-
bioRxiv - Immunology 2020Quote: PBMCs were rested overnight in complete medium and seeded at 2 × 105 cells/well in MultiScreen HTS Filter Plates (Merck Millipore) pre-coated with anti-IFN-γ (clone 1-D1K ...
-
bioRxiv - Plant Biology 2020Quote: ... tumefaciens were resuspended in 50 mM MES (2-Morpholinoethanesulfonic acid hydrate) (Duchefa, Haarlem, The Netherlands) - KOH buffer (pH 5.6) containing 2mM NaH2PO4 (Merck, Darmstadt, Germany), 100 µM acetosyringone (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... used for barrier dysfunction experiments were conducted on a 37 °C heating block using a Millicell ERS-2 Voltohmmeter (Merck-Millipore) equipped with an Ag/AgCl electrode (STX01) ...
-
bioRxiv - Molecular Biology 2021Quote: TEER measurements [22] were performed on 3rd day of incubation with growth factors and (or) different inhibitors by using Millicell ERS-2 Electrical Resistance System (Merck-Millipore). Each insert was measured in three different locations ...
-
bioRxiv - Molecular Biology 2020Quote: ... we repeated the experimental protocol and behavioral battery in wild type zebrafish larvae using 2 μM THC (Merck, Cat. No. T4764), and 0.15 μM nicotine (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... Fractions containing the desired His6-tagged protein were concentrated to 2 ml using Amicon® Ultra Centrifugal Filters (10,000 MWCO, Merck Millipore), and were directly injected into a size-exclusion chromatography column (Superdex 75 16/60 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 2 μl of the enzyme β-glucuronidase (from Helix from Pomatia enzyme aqueous solution, ≥ 100.000 units/mL; Merck, Darmstadt, Germany) to deconjugate DEHP metabolites and BPA ...
-
bioRxiv - Immunology 2021Quote: ... tumors were enzymatically digested with 2,000 U/mL of DNase I and 2 mg/mL of collagenase IV (both from Sigma Aldrich, Merck, Israel) in HBSS for 30 min 37 □ ...
-
bioRxiv - Neuroscience 2021Quote: ... the kinetics of ROS production was evaluated for 2 h after the addition of 2,7-dichloro-diidrofluorescineacetate (DCFH-DA, Merck, Darmstadt, Germany) using the Microplate Reader GloMax fluorimeter (Promega Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fractions corresponding to the elution peak were selected and concentrated to 2-50 mg/mL through the use of Amicon® Ultra-15 Centrifugal Unit (Merck), frozen and stored at −80°C for downstream experiments ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Zoology 2023Quote: ... it was fractionated into the different fatty acid classes over an activated silicic acid column (heated at 120ºC for 2 h; Merck Kieselgel 60) via eluting with 7 ml chloroform ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 10 min at room temperature and stained with the Hemacolor Rapid Staining Kit (Merck Millipore). Images were collected on BX61 upright microscope (Olympus ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
bioRxiv - Biochemistry 2021Quote: ... The cells were fixed for 1 h at room temperature with 4% buffered formalin solution containing 1% crystal violet (Merck, Darmstadt, Germany). Finally ...
-
bioRxiv - Neuroscience 2019Quote: ... before probing overnight at 4°C with primary antibodies (1:500 mouse anti-NF200 [N0142; Sigma-Aldrich] and 1:500 rabbit anti-peripherin (AB1530; Merck Millipore) in blocking solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... The beads were pre-bound with 4-5 micrograms of antibodies (H3K4me3 – Merck 07-473; H3K9me2 Abcam ab1220; H3K27me3 – Acive Motif 39155; H3 – Merck 07-10254; PolII – Abcam ab817) before incubation with the sheared chromatin ...
-
bioRxiv - Molecular Biology 2021Quote: ... resuspended in 6 μL deionized formamide (Merck Life Science) per hybridisation ...
-
bioRxiv - Biophysics 2021Quote: ... 6×His-tagged recombinant MSP1E3D1 (Sigma-Aldrich, Merck, USA) and FLAG-tagged recombinant mCardinal (kindly provided by Jakub Czapiński ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with 6 mM CHIR99021 (Merck Millipore) in DeSR1 media containing DMEM/F12 1% MEM-NEAA (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... and finally dissolved in 6 M guanidine hydrochloride (Merck). 14.4.4 and H57 scFVs were refolded from inclusion bodies in vitro ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked in 5% skim milk in TBS for 1 hour and probed with mouse γ/9d 2G10.2 (1:1000, MERCK MABT1335), rabbit anti mouse IgG (1:3000 ...
-
bioRxiv - Biochemistry 2020Quote: TSEN complexes were mixed to a final concentration of 1 or 3 μM with 4x SYPRO Orange (Merck) stock in 50 mM HEPES-NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... Fibers were washed 3×10 min in PBS and incubated in blocking buffer (1% bovine serum albumin (Merck), 5% goat serum (16210-064 ...
-
bioRxiv - Developmental Biology 2022Quote: ... IWP2 (4 µM; Merck), XAV-939 (10 µM ...
-
bioRxiv - Neuroscience 2019Quote: ... 4 µM aphidicolin (Merck) was used to reduce proliferation and viability of small numbers of non-neuronal cells ...