Labshake search
Citations for Merck :
1101 - 1150 of 6423 citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2023Quote: ... the cells were discarded and N-ethyl-maleimide (Merck, 2 mM) and Pefabloc (Roth ...
-
bioRxiv - Cell Biology 2023Quote: ... actin stabilizer jasplakinolide (Jasp, 50 nM, 2 h, Merck Millipore) or nuclear export inhibitor leptomycin B (LMB ...
-
bioRxiv - Cell Biology 2022Quote: ... medium was replaced with the culture medium containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Cell Biology 2020Quote: ... and Click-iT® EdU (5-ethynyl-2’deoxyuridine) Assay (BCK-EDU488, baseclick GmbH, Merck/Sigma-Aldrich, UK), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck), respectively ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and N,N,N’,N′-tetramethylethylenediamine (TEMED, Sigma-Aldrich, Merck, T7024) were added and 9.5 mL of the mixture was polymerized at room temperature in a Petri dish (92 × 16 mm ...
-
bioRxiv - Cell Biology 2020Quote: ... Stag-Tulp3 was then pulled down from the TEV digestion eluates by overnight 4°C rotational incubation using S-protein agarose beads (Merck, #69704). Beads were then eluted with Laemmli buffer and processed for SDS-PAGE in Novex Value 4-20% Tris-Glycine gels (Thermofisher) ...
-
bioRxiv - Immunology 2021Quote: ... Mouse peritoneal macrophages (MPMs) were isolated from mice 4 d after the intraperitoneal injection of thioglycollate (Merck & Co.; Kenilworth, NJ, USA) as described previously(Zhang et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... The sample was then centrifuged twice at 13000 g for 10 min at 4°C and the supermnatent was passed through Millex® GV 0.22 μm PVDF membrane filter (Merck Millipore). Next ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4°C with a SW28 rotor in a Beckman XL-70 centrifuge or concentrated using an Amicon Ultra-4 10 kDa centrifugal filter device (Merck Millipore). Pellets were resuspended in 500 µL PBS ...
-
bioRxiv - Biophysics 2020Quote: ... Fractions containing monomeric I-Ek/MCC(ANP)-biotin complexes were concentrated with 10kDa Amicon®Ultra-4 centrifugal filters (UFC801024, MERCK), snap frozen in liquid nitrogen and stored in 1x PBS at −80 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 ml of extract was incubated overnight at 4°C with rotation with 20 µg/ml anti-FLAG M2 antibody (Merck, F3165) and 50 µl Pierce magnetic protein A/G beads (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... a blocker of the sarco/endoplasmic reticulum Ca2+-ATPase pump (SERCA) and Carbonyl cyanide 4- (trifluoromethoxy) phenylhydrazone (FCCP, Merck-Sigma-Aldrich), a protonophoric uncoupler of mitochondrial oxidative phosphorylation that depolarizes the mitochondrial membrane and leads to the organelle’s release of calcium ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 min) and alkylated (20 mM iodoacetamide, 30 min, room temperature) and samples concentrated with Amicon Ultra-4 columns (Merck-Millipore), After protein precipitation with methanol/chloroform ...
-
bioRxiv - Microbiology 2020Quote: Feces were hydrated in 500 µL sterile Milli-Q water overnight at 4 °C and then mixed with 500 µL of absolute ethanol (Merck, USA) for 60 min at RT ...
-
bioRxiv - Plant Biology 2020Quote: ... on a LiChroCART® column (LiChrospher 100 RP-18, 125 x 4 mm, 5.0 μm particle size, Merck KGaA, Darmstadt, Germany), with constant flow rate of 1 mL min-1 of 100% solvent A (acetonitrile ...
-
bioRxiv - Microbiology 2020Quote: ... To perform this, tissues were fixed over a filter paper imbibed with 30% sucrose (Winkler, Chile) in PBS–4% paraformaldehyde (Merck, USA) for at least 15 min ...
-
bioRxiv - Plant Biology 2021Quote: ... Individual carotenoids were quantified in a Shimadzu HPLC (LC-10AT) with a diode array detector using a RP-18 Lichrocart 125-4 reverse phase column (Merck®) and a mobile phase composed of acetonitrile:methanol:isopropanol (85:10:5 v/v) ...
-
bioRxiv - Systems Biology 2021Quote: ... Excess FSBA reagent was removed by ultracentrifugation with 15 mL 10 K MWCO Amicon® Ultra-4 centrifugal filter units (Merck) at 3,500 × g at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... and EV-containing fractions were pooled and concentrated with a 10 kDa molecular weight cut-off Amicon Ultra-4 centrifugal filter unit (Merck Millipore).
-
bioRxiv - Cell Biology 2022Quote: KELLY cells were grown on 20 x 14 cm dishes and treated for 14-16 hours with 100 µM of 4-Thiouridine (Merck, T4509). Cells (1.6 × 108 ...
-
bioRxiv - Neuroscience 2022Quote: ... was either boiled with 4x SDS sample buffer (4% SDS, 40% glycerol, 20% ß-Mercaptoethanol in 250 mM Tris-HCl, Merck) at 95°C ...
-
bioRxiv - Biophysics 2022Quote: ... for 10 min prior to fixation after washing out puromycin were fixed with 4% PAF for 30 min at 37°C and subjected to immunoblotting using puromycin antibody (Merck, MABE343). For the negative control ...
-
bioRxiv - Cancer Biology 2022Quote: IACS-010759 (from the Institute for Applied Cancer Science at MD Anderson)15 and 4-hydroxytamoxifen (Merck Life Science, Darmstadt, Germany) were dissolved in DMSO and ethanol ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... enzymes were concentrated by centrifugation in Centriprep® 30K and Amicon® Ultra-4 Ultracel®-10K devices (Merck Millipore Ltd). Purity of enzymes was assessed by SDS–polyacrylamide gel electrophoresis ...
-
bioRxiv - Plant Biology 2021Quote: ... The solution was left at 4°C on a rotator for 10 min before being filtered twice through Miracloth (Merck Millipore) and spun at 1,000 g for 20 min at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The eluted fractions were concentrated (Amicon Ultra-4 Centrifugal Filter Unit with Ultracel-30 membrane, EMD Millipore, Merck, Burlington MA, USA) and purified by size exclusion chromatography using a Superdex 200 Increase 10/300 (GE LS ...
-
bioRxiv - Neuroscience 2022Quote: ... To fix the cells they were washed once with warm PBS and incubated for 20 min at 37°C with 4 % paraformaldehyde (Merck Millipore). After washing ...
-
bioRxiv - Microbiology 2020Quote: ... 150 mM NaCl and 10 % glycerol) using an Amicon® Ultra-4 regenerated cellulose NMWL 10 kDa centrifugal filter unit (Merck). The protein was then stored as 50 μl aliquots at −80°C ...
-
bioRxiv - Plant Biology 2021Quote: ... were moved to new tubes and concentrated at 14,000×g for 10 min at 4 °C using Amicon ultra-0.5 ml centrifugal filters (catalog number Z677094, Merck millipore, Sweden). Thylakoid ...
-
bioRxiv - Immunology 2020Quote: ... samples were centrifuged at 22000 x g for 20 minutes at 4 °C and the supernatant was filtered through Millex GV 220 nm filter (Merck-Millipore). For acid treatment acetic acid was used with 0.1 N final concentration ...
-
bioRxiv - Genetics 2020Quote: ... of total protein suspended in loading buffer were separated by SDS-PAGE using 8% or 4-20% gradient gels and transferred onto PVDF membranes (Immobilon-P or Immobilon PSQ, Merck Millipore) for immunostaining ...
-
bioRxiv - Cell Biology 2022Quote: ... the samples were first concentrated by centrifugation at 4,000 x g at 21°C using Amicon® Ultra-4 Centrifugal Filter Unit with 100kDa molecular weight cutoff (UFC810024, Merck Millipore ...
-
bioRxiv - Plant Biology 2022Quote: ... Fractions containing BirA were pooled and concentrated in Amicon® Ultra-4 Centrifugal Filter Units (Ultracel®-3K, Merck Millipore Ltd), with a subsequent buffer exchange to 6 M Urea ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peak fractions containing the Swi2-Swi5 complex were concentrated using an Amicon Ultra-4 (50 k) centrifugal filter (UFC805008, Merck Millipore). After cleavage ...
-
bioRxiv - Plant Biology 2022Quote: ... Fractions containing CLPB3 were pooled and concentrated in Amicon® Ultra-4 Centrifugal Filter Units (Ultracel®-3K, Merck Millipore Ltd), with a subsequent buffer exchange to 6 M Urea ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were resuspended in 80% methanol-water and a volume of 4 μL was injected on a SeQuant ZIC/pHILIC Polymeric column (Merck Millipore). The separation of metabolites was achieved at 25°C with a flow rate of 0.20 ml/min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tumors were isolated from lungs and a tissue reference piece was separated and fixed in 4% paraformaldehyde (MERCK, Kenilwork, NJ, USA) overnight at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... The samples were next supplemented with 100 µl of 4 mM methoxypolyethylene glycol maleimide (PEG-maleimide) (5000; Merck, cat. No. 63187) in the SDS buffer ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... were electrophoresed on SDS polyacrylamide gels ( NuPAGE™ 4-12% Bis-Tris Protein Gels; InvitrogenTM) and transferred to PVDF membranes (Millipore; Merck). Membranes were blocked in 2.5% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... Fractions containing the protein of interest were pooled and concentrated using an Amicon® Ultra-4 3K centrifugal filter unit (Merck) according to the manufacturer’s recommendation ...
-
bioRxiv - Neuroscience 2023Quote: ... quality of the elution was assessed by loading 50µl of the resulting elution on a pre-cast 4-15% gradient gel (Merk, MP41G15) and incubated with SYPRO RUBY (Merck, S4942) protein gel stain ON at RT ...