Labshake search
Citations for Merck :
1001 - 1050 of 4581 citations for 7 Bromo 2 4 fluoro phenyl imidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 10 min at room temperature and stained with the Hemacolor Rapid Staining Kit (Merck Millipore). Images were collected on BX61 upright microscope (Olympus ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nuclei pellet was washed once in 5 mL of Honda buffer then purified on a Percoll density gradient as follows: 2 mL of 75% Percoll (Merck, P7828) in Honda buffer topped with 2 mL of 40% Percoll in Honda buffer topped with the nuclei pellet resuspended in Honda buffer in a 15 mL tube ...
-
bioRxiv - Plant Biology 2023Quote: ... and incubated at 28°C shaking at 200 rpm for 2–3 h before plating on LB agar supplemented with 50 µg/ml Kanamycin (Merck Millipore). The plates were incubated for 2– 3 days at 28°C ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Microbiology 2023Quote: MDCK cells (2 x 105 cells) were cultured on polycarbonate Millicell culture plate inserts (12- mm diameter, 3-µm pore size; Merck Millipore) at 37°C under 5% CO2 atmosphere.
-
bioRxiv - Developmental Biology 2023Quote: Cells were homogenized in 20 mM Tris-HCl buffer (pH 7.2, 0.2 mM EGTA, 5 mM β-mercaptoethanol, 2% (v/v) antiprotease cocktail (Merck KGaA, Germany), 1 mM PMSF ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Neuroscience 2024Quote: ... the elution of the biotinylated proteins was carried out boiling the beads in 25 μl of 3X protein loading buffer supplemented with 20 mM DTT and 2 mM Biotin (Merck, B4501) for 10 min at 95°C in gentle shaking ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were incubated with following primary antibodies at 4 °C overnight: TRA-1-60 (Merck Millipore), OCT3/4 (H-134 ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Developmental Biology 2021Quote: ... iPSC-derived mesodermal cells were fed with basal medium supplemented with 4 μM IWR-1 (Merck) for 48 h ...
-
bioRxiv - Neuroscience 2021Quote: ... or Cy5-conjugated secondary antibodies (1:200; AP192SA6; Merck Millipore, USA; 17 hrs at 4°C). Similar immunolabeling steps were followed for the subsequent sequential staining ...
-
bioRxiv - Immunology 2020Quote: ... BJ-5at fibroblasts were kept in a 4:1 mixture of the Dulbecco’s Medium (Merck, #D6429) and Medium 199 (Gibco ...
-
bioRxiv - Biochemistry 2021Quote: ... The cells were fixed for 1 h at room temperature with 4% buffered formalin solution containing 1% crystal violet (Merck, Darmstadt, Germany). Finally ...
-
bioRxiv - Neuroscience 2019Quote: ... before probing overnight at 4°C with primary antibodies (1:500 mouse anti-NF200 [N0142; Sigma-Aldrich] and 1:500 rabbit anti-peripherin (AB1530; Merck Millipore) in blocking solution ...
-
bioRxiv - Cancer Biology 2022Quote: Commercial gDNA was used for the assay validation: MCF-7 cell line (Merck, #86012803), leukocyte (AMS Bio ...
-
bioRxiv - Neuroscience 2022Quote: For the presentation of the odour (n-amylacetate, AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Microbiology 2022Quote: ... Tomato was cultured in ½ Hoagland’s medium in GA-7 Magenta vessels (Sigma-Aldrich/Merck), 6 plants per vessel ...
-
bioRxiv - Bioengineering 2024Quote: ... Unfractionated Bovine Bile (CAS No – 8008-63-7, B3883-25G) was purchased from Merck Millipore GmbH ...
-
bioRxiv - Cell Biology 2023Quote: ... Kidney fibroblast-like cells (COS-7) from the African green monkey Cercopithecus aethiops (Merck, Darmstadt ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tissue homogenization was performed using a 7 mL glass Dounce tissue grinder set (Merck) with 8 strokes of a loose and a tight pestle in homogenization buffer (250 mM sucrose ...
-
bioRxiv - Developmental Biology 2022Quote: ... IWP2 (4 µM; Merck), XAV-939 (10 µM ...
-
bioRxiv - Neuroscience 2019Quote: ... 4 µM aphidicolin (Merck) was used to reduce proliferation and viability of small numbers of non-neuronal cells ...
-
bioRxiv - Cell Biology 2021Quote: ... 4% sucrose (Merck, S0389) in D-PBS for 15 min and permeabilized with 0.05% saponin (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 µM aphidicolin (Merck) was used to reduce proliferation and viability of small numbers of non-neuronal cells (Loreto and Gilley ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4% PFA-fixed (Merck) and paraffin-embedded tissues were cut into 15 μm sections (IHC ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 g PFA (Merck) was dissolved in 80 ml PBS heated to 60 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Germany)/ 4% paraformaldehyde (Merck, Germany) in 0.05 M cacodylate buffer pH 7.4) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-OHT (Merck, #H6278) was dissolved in ethanol at 1 mM and used at a final concentration of 0.5 μM in the culturing medium.
-
bioRxiv - Neuroscience 2024Quote: ... and incubated o/n at 4°C with the primary antibodies (Rabbit-antiGFAP: MAB3402, Merck Millipore, 1:500; Mouse-antiNeuN: MAB377, Merck Millipore, 1:500) diluted in the blocking solution ...
-
bioRxiv - Biochemistry 2021Quote: ... PTP1B KO Ramos were transfected with a doxycycline inducible tet-on vector and exposed to 2 μg/ml doxycycline (Calbiochem, Merck, Darmstadt, Germany) 24 to 48 h before the experiment ...
-
bioRxiv - Cell Biology 2020Quote: ... for 3h at 16°C to remove the 6-His and MBP tag before phase separation in reaction mixtures in buffer C containing 10μM of WT or W1145R TopBP1b6-8-GFP and 2% of PEG4000 (Merck-Sigma-Aldrich, 95904). Reaction mixtures were mixed by gently tapping the Eppendorf ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa cells were allowed to adhere overnight (16 h) in the presence of 2 mM Thymidine (S-phase block; Merck, Darmstadt, Germany) and released into fresh medium ...
-
bioRxiv - Microbiology 2019Quote: ... Under these conditions nitrite was not detectable with a colorimetric test with a lower detection limit of 2 mg/L (MQuant test stripes, Merck, Darmstadt, Germany). Growth conditions and operation of the bioreactor containing ANME-2d archaea enriched from an Italian paddy field soil are described by Vaksmaa et al. ...
-
bioRxiv - Neuroscience 2021Quote: TEER across cellular monolayers was measured with chopstick electrodes in 24-well Transwell inserts using the Millicell® ERS-2 Voltohmmeter (Merck Millipore). The absolute TEER of eGFP-hCldn5-MDCK II cells before treatment was recorded as a baseline reading ...
-
bioRxiv - Biochemistry 2021Quote: ... and subsequent thorough rinsing with ultrapure water (18.2 MΩ at 25 °C, maximum 2 ppb total organic carbon, Milli-Q Integral 5 Water Purification System, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Biochemistry 2020Quote: DNA encoding for Pry1 and Na-ASP-2 were PCR amplified and cloned into NcoI and XhoI restriction sites of pET22b vector (Novagen, Merck, Darmstadt, Germany), which contains a pelB signal sequence to direct the secretion of expressed protein into the periplasmic space ...
-
bioRxiv - Plant Biology 2021Quote: ... 1000 μl tips were fitted with 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 10 μg of LiChroprep® RP-18 peptides (Merck). Tips were sequentially equilibrated with 100 % methanol ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracted peptides were dried in a speed-vac and resuspended in (v/v) 2% acetonitrile/0.2% trifluoroacetic acid (Merck, catalog no. 302031). A total of four biological replicates for each sample type was submitted.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The protein was concentrated overnight to a volume of 2 mL in a Vivaspin 20 Ultrafiltration Unit (5 kDa MWCO)(Merck, Darmstadt, Germany) and then loaded onto a HiLoadTM 26/60 Superdex TM 75 prep grade (GE Healthcare ...
-
bioRxiv - Biochemistry 2021Quote: ... The total extract of proteins was then centrifuged for 20 min at 20,000 g and the soluble fraction loaded on an affinity chromatography with 2 ml of NiNTA resin (Sigma-Aldrich Merck, Darmstad Germany). The resin was washed with 20 ml of 20 mmol/L Tris-HCl (pH7.9 ...