Labshake search
Citations for Merck :
1001 - 1050 of 5258 citations for 4 Bromo 3' 1 3 dioxolan 2 yl 2 fluorobenzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... 2 µL Benzonase® nuclease HC (250 U/µL, Merck Millipore) was added and incubated for 30 min (37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... for 2 hours and immunolabelled with anti-collagen VI antibody (Merck Millipore ...
-
bioRxiv - Molecular Biology 2024Quote: ... 213 µg/ml L-ascorbic acid 2-phosphate (ref. A8960, Merck) and 0.5 µg/ml BSA fraction V (ref ...
-
bioRxiv - Biochemistry 2024Quote: ... ZM241385 and 2,2’-azobis(2-amidinopropane) dihydrochloride were purchased from Merck.
-
bioRxiv - Microbiology 2024Quote: ... Two millilitres of 2% osmium tetroxide (ReagentPlus®, 99.8%, Merck, Germany) in distilled water were added to the samples immediately after removal of the buffer and incubated for an additional 30 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were incubated in DAPI (2 µg/ml, 10236276001, Roche Merck) in PBS (10 min) ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 50 μM 2-Phospho-L-ascorbic acid (Merck, 49752). Frozen stocks were prepared at passage 4 and used for all subsequent experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 µM Trolox ([±]-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Merck), 100 µM nocodazole and 1 nM NAP (a gift from Illana Gozes ...
-
bioRxiv - Microbiology 2024Quote: ... The chemical reagents puromycin (58-58-2) was purchased from Merck Millipore ...
-
bioRxiv - Developmental Biology 2020Quote: ... all other conditions: N=3) in the presene of 4µg/ml polybrene (cat. TR-1003-G, Merck) (Supplementary Figure 2) ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2020Quote: ... and proteins were eluted using 100 µl of 150 ng/µl 3× FLAG Peptide (F4799, Merck KGaA) or HA peptide (HY-P0239 ...
-
bioRxiv - Neuroscience 2022Quote: ... animals were briefly anesthetized with isofluorane and 200nl of 3 nM clozapine-N-oxide (CNO, #C0832, Merck) was infused bilaterally via implanted cannulae in ACx using a Hamilton syringe (10 μl ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mM MgCl2) using Amicon Ultra-0.5 mL Centrifugal Filters (30 or 100 K MWCO, Merck Millipore). After re-measuring the concentrations by densitometry ...
-
bioRxiv - Biochemistry 2020Quote: ... before Rab8a was washed 3 times with PBS in an Amicon filter (Merck Millipore, 10 kDa NMWL). Incorporation of label was confirmed by MS.
-
bioRxiv - Cancer Biology 2022Quote: ... and functionalized by 200 µl of a 3% (v/v) solution of hyaluronic acid (HA) (Merck, Germany) at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... Japan) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a LCMS-8060NX ...
-
bioRxiv - Microbiology 2021Quote: Full-length CA sequences derived from pNL4-3 was introduced to pET30a vectors (Novagen-Merck KGaA, Germany), producing a pET30a CA vector ...
-
bioRxiv - Immunology 2021Quote: ... Calu-3 cells were transduced by addition of lentiviral supernatants containing 8 μg/ml polybrene (Merck Darmstadt). 48 hours after transduction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7 using repetitive washing and centrifugation with an Amicon 3 kDa MWCO centrifugal filter (Merck Millipore). For the synthesis of ditopic A’-A’ CC ligand ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and fixed for at least 3 h with 70% ethanol (Merck, 100983). Cells were washed with PBS and analyzed by using the Cell Cycle Kit (Luminex Corporation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore catalogue no. UFC500396) and centrifuged for 45 min at 4 °C at 12,000g ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein-containing fractions were pooled and concentrated on an Amicon 3 kDa MWCO spin concentrator (Merck Millipore). After another IMAC purification step using Ni-NTA resin ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... The desired concentration was achieved using Amicon® Ultra centrifugal filter units (3 kDa cutoff – Merck Millipore).
-
bioRxiv - Immunology 2022Quote: ... for 1 hour at RT and washed 3 times with TBS/Tw (TBS containing 0.05% v/v Tween-20 (8.17072.1000, Merck)) ...
-
bioRxiv - Biochemistry 2022Quote: ... The aE11-Fab sample was concentrated by centrifugal concentrator with a MWCO of 3 kDa (Merck Millipore) and further purified by size exclusion chromatography into 20 mM Tris ...
-
bioRxiv - Cell Biology 2024Quote: ... they were washed four times for 3 minutes with PBS and mounted in Mowiol reagent (81381, Merck). The image acquisition was done on a Zeiss LSM880 confocal microscope running the software Zeiss ZEN2.3 SP1 FP3 (black ...
-
bioRxiv - Bioengineering 2023Quote: ... unreacted biotin-pentylamine was removed by ultrafiltration with a 3 or 10 kDa MWCO membrane (Merck Millipore). The recovered upper residual liquid (∼100 μL ...
-
bioRxiv - Systems Biology 2023Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument (PFPP-LC/MS/MS) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The gelatinous sack surrounding the eggs was removed by incubation in 3% L-Cysteine (Merck Millipore, USA) while rotated by hand for 15 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument ...
-
bioRxiv - Biochemistry 2022Quote: ... # T7408) using an ultrafiltration cartridge (Amicon Ultra 0.5 mL 3 K; Merck, Readington, NJ, USA; Cat. # UFC500324). The total protein levels in the samples were assayed using the Pierce™ BCA Protein Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cell extracts were concentrated using Amicon Ultra-15 3 kDa cutoff (Merck Millipore, Burlington, MA, USA). The obtained cell extract was flash-frozen in liquid nitrogen and preserved at −80 °C until further use.
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... glutamine-free RPMI was supplemented with 2mM [1,5-15N]-L-Glutamine or [3-13C]-L-Glutamine (Merck).
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Cell Biology 2024Quote: ... The eluate from each column was pooled and concentrated in a 3 KD amicon column (Merck, UFC5003) to just under 100 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were later exposed to a 3% bovine serum albumin (BSA, A3912, Merck Life Science, Milan, Italy) solution in DPBS containing 0,1% Triton at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AQR-GFP plasmid (RG220742) was used for the mutagenesis with KOD polymerase (Merck/Millipore, 71086□3), used according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: GMPCPP-stabilized microtubules were grown using a mixture of 1.3 mg ml−1 tubulin and 2 mM GMPCPP (Merck, NU-405L) in BRB80 and incubated for 1 hour (stepping and photobleaching assay ...
-
bioRxiv - Neuroscience 2021Quote: ... The brains were removed and post-fixed for 1-2 days and then transferred to 30% sucrose (Merck KGaA, Darmstadt, Germany) dissolved in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... All samples were further concentrated to a final volume of 1-2 ml using 100 kDa Amicon-ultra filters (Merck Millipore).
-
bioRxiv - Cell Biology 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 10 kDa ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were subsequently washed with PBS and incubated for 2 h with the proper secondary antibodies (1:300, goat anti-rabbit Alexa-Fluor® 647, AP187SA6, Merck Millipore ...
-
bioRxiv - Paleontology 2020Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Biochemistry 2020Quote: ... The lipids were resuspended in a small volume of chloroform/methanol (2:1) and applied to a to HPTLC plate (Silica Gel 60, Merck, Germany) together with DOPC/cholesterol and NeuGc/NeuAc GM3 as standards ...
-
bioRxiv - Microbiology 2020Quote: ... and the other stored at −80 °C in a sterile 2 ml cryovial containing 1 ml of a 30 % glycerol solution, prepared by diluting glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...