Labshake search
Citations for Merck :
951 - 1000 of 1863 citations for 3 7 Diethyl 2 hydrazinoquinoline hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... before Rab8a was washed 3 times with PBS in an Amicon filter (Merck Millipore, 10 kDa NMWL). Incorporation of label was confirmed by MS.
-
bioRxiv - Cancer Biology 2022Quote: ... and functionalized by 200 µl of a 3% (v/v) solution of hyaluronic acid (HA) (Merck, Germany) at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... Japan) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a LCMS-8060NX ...
-
bioRxiv - Microbiology 2021Quote: Full-length CA sequences derived from pNL4-3 was introduced to pET30a vectors (Novagen-Merck KGaA, Germany), producing a pET30a CA vector ...
-
bioRxiv - Immunology 2021Quote: ... Calu-3 cells were transduced by addition of lentiviral supernatants containing 8 μg/ml polybrene (Merck Darmstadt). 48 hours after transduction ...
-
bioRxiv - Immunology 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Biochemistry 2022Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument ...
-
bioRxiv - Biochemistry 2022Quote: ... # T7408) using an ultrafiltration cartridge (Amicon Ultra 0.5 mL 3 K; Merck, Readington, NJ, USA; Cat. # UFC500324). The total protein levels in the samples were assayed using the Pierce™ BCA Protein Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cell extracts were concentrated using Amicon Ultra-15 3 kDa cutoff (Merck Millipore, Burlington, MA, USA). The obtained cell extract was flash-frozen in liquid nitrogen and preserved at −80 °C until further use.
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... The desired concentration was achieved using Amicon® Ultra centrifugal filter units (3 kDa cutoff – Merck Millipore).
-
bioRxiv - Immunology 2022Quote: ... for 1 hour at RT and washed 3 times with TBS/Tw (TBS containing 0.05% v/v Tween-20 (8.17072.1000, Merck)) ...
-
bioRxiv - Biochemistry 2022Quote: ... The aE11-Fab sample was concentrated by centrifugal concentrator with a MWCO of 3 kDa (Merck Millipore) and further purified by size exclusion chromatography into 20 mM Tris ...
-
bioRxiv - Genomics 2024Quote: ... Traps deployed by BCC were also baited with 1-octen-3-ol (Merck Life Science, Bayswater, Australia) (van Essen et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... they were washed four times for 3 minutes with PBS and mounted in Mowiol reagent (81381, Merck). The image acquisition was done on a Zeiss LSM880 confocal microscope running the software Zeiss ZEN2.3 SP1 FP3 (black ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein-containing fractions were pooled and concentrated on an Amicon 3 kDa MWCO spin concentrator (Merck Millipore). After another IMAC purification step using Ni-NTA resin ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore catalogue no. UFC500396) and centrifuged for 45 min at 4 °C at 12,000g ...
-
bioRxiv - Bioengineering 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APTS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... glutamine-free RPMI was supplemented with 2mM [1,5-15N]-L-Glutamine or [3-13C]-L-Glutamine (Merck).
-
bioRxiv - Bioengineering 2023Quote: ... unreacted biotin-pentylamine was removed by ultrafiltration with a 3 or 10 kDa MWCO membrane (Merck Millipore). The recovered upper residual liquid (∼100 μL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and fixed for at least 3 h with 70% ethanol (Merck, 100983). Cells were washed with PBS and analyzed by using the Cell Cycle Kit (Luminex Corporation ...
-
bioRxiv - Systems Biology 2023Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument (PFPP-LC/MS/MS) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The gelatinous sack surrounding the eggs was removed by incubation in 3% L-Cysteine (Merck Millipore, USA) while rotated by hand for 15 minutes ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were later exposed to a 3% bovine serum albumin (BSA, A3912, Merck Life Science, Milan, Italy) solution in DPBS containing 0,1% Triton at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... The eluate from each column was pooled and concentrated in a 3 KD amicon column (Merck, UFC5003) to just under 100 μl ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AQR-GFP plasmid (RG220742) was used for the mutagenesis with KOD polymerase (Merck/Millipore, 71086□3), used according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with rabbit-α-pH3Ser10 (1:250 for 3 hours at room temperature; Merck Millipore, Burlington, MA), incubated with goat-α-rabbit-AF568 (1:250 for 45 minutes at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... purified ParB was concentrated by centrifugation in an Amicon Ultra-15 3-kDa cut-off spin filters (Merck) before being loaded into a Superdex 75 gel filtration column (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mo and PN were then washed in DMEM and placed in 3 μm Boyden chambers (Merck Millipore, France), at the concentration of 0.5 x 106 cells/chamber in 200 µl DMEM ...
-
bioRxiv - Biochemistry 2020Quote: TSEN complexes were mixed to a final concentration of 1 or 3 μM with 4x SYPRO Orange (Merck) stock in 50 mM HEPES-NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... purified ParBΔCTD was concentrated by centrifugation in an Amicon Ultra-15 3-kDa cut-off spin filters (Merck) before being loaded into a Superdex-200 gel filtration column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... and HPLC separation with a ZIC®-cHILIC column (3 µm, 100 Å, 150 mm × 2.1 mm, Merck) and a similar guard column (20 mm × 2.1 mm ...
-
bioRxiv - Physiology 2020Quote: ... at 4°C for 60 min using an Amicon Ultra-4 3 kDa centrifugal filter device (Merck Millipore). The 50 μL retentate was the final volume of concentrated EVs ...
-
bioRxiv - Immunology 2020Quote: ... rAAVDJ or rAAV6 genome plasmid and Donor plasmid at a 3:1:1 ratio in Polyethylenimine (PEI)(Merck). In total each plate was teransfected with 41,250ng of DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... The corresponding GST fusion protein was added to a final concentration of 15 µg/ml in incubation buffer (10 mM Tris pH 8.0, 150 mM NaCl, 0.1 % Tween-20, 3 % BSA (fatty acid free, Merck)) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... F2 FLAG-tagged TBP::NveRLR::mCherry and wild-type zygotes were treated with 3% L-Cysteine (Merck Millipore), washed and snap frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 µL of sample was carefully spotted onto pre-washed PEI-cellulose TLC plates (Merck Millipore, #105725). The TLC plate was eluted in developing buffer containing 10 mM NH4Cl and 5% acetic acid for 100-140 min ...
-
bioRxiv - Neuroscience 2020Quote: ... the eluate was up-concentrated to 3 ml using an Amicon Ultra 3000 MW centrifugal filter unit (Merck). Concentration assessment with a NanoDrop (∊ = 2980 ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfections of DNA plasmids were carried out with the NanoJuice Transfection Kit (71900-3, Merck, Kenilworth, NJ, USA) or the Avalanche-Everyday Transfection Reagent (EZT-EVDY-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... expanding cells were transferred to erythroid differentiation medium (Iscove’s medium with stable glutamine [Merck] containing 3% (v/v) AB serum [Merck] ...
-
bioRxiv - Cell Biology 2022Quote: ... Fibers were washed 3×10 min in PBS and incubated in blocking buffer (1% bovine serum albumin (Merck), 5% goat serum (16210-064 ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was concentrated to ∼500 μL using Amicon Ultra-15 Centrifugal Filter Units (Merck Millipore MWCO 3 kDa). The concentration of proteins was determined using JASCO V730 UV-vis spectrophotometer at 280 nm ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Microbiology 2023Quote: Supernatants showing biological activity were concentrated using Amicon Ultra-0.5 centrifugal filters (3 kDa) (Merck KGaA, Darmstadt, Germany) as follows ...
-
bioRxiv - Genetics 2023Quote: ... Supernatant was then transferred to an Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore, no. UFC500396) and centrifuged for 45 min at 4 °C ...