Labshake search
Citations for Merck :
51 - 100 of 3202 citations for 7 TRIFLUOROMETHYL 2 3 4 5 TETRAHYDRO 1H BENZO B AZEPINE HYDROCHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL lipid extract was injected on a LiChroCART 250–4 LiChrospher® Si 60 (5 μm) (Merck) maintained at 25 °C ...
-
Observation of an α-synuclein liquid droplet state and its maturation into Lewy body-like assembliesbioRxiv - Molecular Biology 2020Quote: ... and 10 mM levamisole hydrochloride (Merck) on a glass-bottom imaging dish (MatTek P35G-1.5-14-C) ...
-
bioRxiv - Genetics 2023Quote: ... L-Carnitine hydrochloride (Merck, C0283-5G), and acetic acid (Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was supplemented with calcium chloride to a final concentration of 3 mM and chromatin was solubilised for 2 h at 4 °C by digestion with Turbonuclease (T4330, Merck) to a final concentration of 250U/ml ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... Surfaces were functionalised by flooding the device with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500™ (3M™) ...
-
bioRxiv - Biochemistry 2024Quote: ... Diener Electronic) followed by channel surface functionalization using 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl) silane (Merck) in HFE-7500™ (3M™ Novec™).
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Physiology 2023Quote: ... Blots were washed 3 x for 7 min with TBS-T (200 mM Tris (Merck), 1.36 mM NaCl (Merck) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Biophysics 2019Quote: ... Fragments (2 mM in DMSO) were injected (2 μL) onto a Purospher STAR RP-18 end-capped column (3 μm, 30 × 4 mm, Merck KGaA). Chromatographic separation was carried out over a 4-min gradient elution (90:10 to 10:90 water:methanol ...
-
bioRxiv - Microbiology 2023Quote: ... Hydrophobic surface treatment was performed after bonding by flushing with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 and ...
-
bioRxiv - Cell Biology 2023Quote: ... The blots were developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-brom-4-chlor-3-indoxylphosphate (BCIP; Merck, Darmstadt, Germany) for 5–30 min at RT ...
-
bioRxiv - Microbiology 2021Quote: ... or 125 μM Propranolol hydrochloride (Merck, 40543) for 7 min).
-
bioRxiv - Biochemistry 2023Quote: ... 10 mM methylamine hydrochloride (Merck, Munich, Germany) and approximately 0.3-0.5 mM KCl at -80°C.
-
bioRxiv - Neuroscience 2023Quote: ... and ambroxol hydrochloride (#A9797, Merck, London, UK) were diluted in DMSO to obtain a 10mM stock solution ...
-
bioRxiv - Neuroscience 2023Quote: ... Propranolol-Hydrochloride (10 mg/kg, Merck, Germany), Prazosin-Hydrochloride (1 mg/kg ...
-
bioRxiv - Neuroscience 2023Quote: ... Prazosin-Hydrochloride (1 mg/kg, Merck, Germany) and Clozapine (0.03mg/kg ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Microbiology 2023Quote: ... We used sterile-filtered 3 % bovine serum albumin (BSA heat shock fraction, pH 7, > 98 %, Merck) in 1 × Pierce PBS buffer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... at a final concentration of 5 μg/ml or Latrunculin B (428020-1MG, Merck) at a final concentration of 5 μM in M2 medium supplemented with dbcAMP ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Biochemistry 2022Quote: The matrix 2′,5′-dihydroxyacetophenone (DHAP; Merck) was applied by sublimation and the data were acquired on a modified timsTOF fleX instrument (Bruker Daltonics ...
-
bioRxiv - Immunology 2024Quote: ... U-937 cells were maintained in RPMI-1640 medium supplemented with 4.5 g/L glucose, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1.0 mM sodium pyruvate (Sigma-Aldrich; Merck KGaA), 10% fetal bovine serum (Hyclone ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... morphine hydrochloride was purchased from Merck (Darmstadt, Germany) and naloxone-HCl was purchased from Cayman Chemical (Ann Arbor ...
-
bioRxiv - Biophysics 2020Quote: ... Serotonin-hydrochloride was purchased from Merck (Darmstadt, Germany). Chloroform and methanol AR graded were purchased from S ...
-
bioRxiv - Molecular Biology 2022Quote: ... and vancomycin hydrochloride (unlabelled) were purchased from Merck Inc ...
-
bioRxiv - Cancer Biology 2019Quote: ... 72 hrs or 7 days after adding the drugs organoids were fixed with 4% PFA (Merck) and stained with Hoechst (Invitrogen) ...
-
bioRxiv - Plant Biology 2023Quote: ... while 4-chloro-7-nitrobenzoxadiazole (NBD-Cl, 97%, Sigma-Aldrich, Merck Group, St Louis, MO, USA) was applied at 270LgLha−1 of active ingredient ...
-
bioRxiv - Immunology 2021Quote: ... either 4′,6-Diamidine-2′-phenylindole dihydrochloride (Merck) or LIVE/DEAD™ Fixable Near-IR stain kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... 4′,6-Diamidine-2′-phenylindole dihydrochloride (10236276001, Merck); Dox-NP (300112 ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of chloroform:isopropanol 2:1 (v:v)(Merck) were used to elute the neutral lipid fraction (NL) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7 using repetitive washing and centrifugation with an Amicon 3 kDa MWCO centrifugal filter (Merck Millipore). For the synthesis of ditopic A’-A’ CC ligand ...
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Bioengineering 2020Quote: ... the master was first placed in a vacuum desiccator beside a glass petri dish containing a droplet of trichloro(1H,1H,2H,2H-perfluorooctyl)-silane (Merck KGaA, Darmstadt, Germany), which subsequently coated the surface of the master with a hydrophobic layer allowing easy future peeling of the polydimethylsiloxane (PDMS ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Systems Biology 2020Quote: Wnt signal inhibitor (CK) stock (2.4–3 mM): CKI-7 dihydrochloride (#C0742-5MG, Merck & Co., Inc., NJ, USA) diluted in distilled water (Otsuka Pharmaceutical Factory ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and prinomastat hydrochloride (≥95% HPLC, Cat no: PZ0198, Merck), all resuspended at 1 mg/mL in water ...
-
bioRxiv - Microbiology 2021Quote: ... target cells were pre-incubated with Bromhexine hydrochloride (Merck), Ambroxol hydrochloride (Merck) ...