Labshake search
Citations for Merck :
51 - 100 of 1584 citations for 7 BENZYLOXY 3 METHYL 5 NITROINDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: BCP and BG samples dehydrated and embedded in poly-methyl-methacrylate resin (Merck KGaA). Sections performed with Leica SP1600 microtome (Wetzlar ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ACV(9-[(2-Hydroxyethoxy)methyl]guanine) was obtained as a gift sample from Merck, India ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Carbamate (aldicarb) and organophosphates (paraoxon-ethyl, paraoxon-methyl and DFP) were acquired from Merck and dissolved in 70% ethanol and 100% DMSO ...
-
bioRxiv - Microbiology 2023Quote: ... Trimethylsilyl methyl glycosides were obtained by derivatization with the reagent Sylon™ HTP (Merck) after methanolysis of the polysaccharide with 3 M HCl in methanol at 85°C for 16 h (69) ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Molecular Biology 2022Quote: ... was placed on the top of a water-cooled glass column (33 × 2.5 cm) filled with a slurry of silica gel 60 (with the addition of 7 % water, 40 – 63 μm, Merck, Darmstadt, Germany, # 1.09385.2500) and n-pentane ...
-
bioRxiv - Biophysics 2020Quote: 22) Glucose (Merck, CAS #14431-43-7)
-
bioRxiv - Microbiology 2024Quote: ... 100% xylene (Merck, CAS-1330-20-7) for 10 minutes (3 times) ...
-
bioRxiv - Cell Biology 2023Quote: ... 7 U/ml creatine phosphokinase (Merck, C3755)) as well as an oxygen scavenger system (0.2 mg/ml catalase (Merck ...
-
bioRxiv - Physiology 2024Quote: ... U73122 was from Merck (112648-68-7) and eserine from MedChemExpress (HY-N6608) ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.625 mM TBTA (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine) (Merck Millipore), and 6.25 mM CuSO4 (Merck Millipore) ...
-
bioRxiv - Bioengineering 2020Quote: ... The structures were developed in propylene glycol methyl ether acetate (PGMEA, Merck KGaA, Darmstadt, Germany) for 25 minutes followed by 5 minutes of treatment with isopropyl alcohol (IPA ...
-
bioRxiv - Microbiology 2023Quote: ... supernatants were coated with overlay medium (1.5% methyl cellulose (w/v) (Merck KGaA; Darmstadt, Germany), 1x MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Biochemistry 2022Quote: ... Reversible blockage of cysteines was performed with S-methyl methanethiosulfonate (MMTS, Merck, Sigma-Aldrich, 64306-1ML) at 4 mM for 30 min at room temperature ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.48 mM MgSO4 x 7 H2O (Merck, 1058860500), 1.2 mM KCl (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... anti-HA (HA-7, H3663, lot 066M4837V, Merck) 1/1,000 ...
-
bioRxiv - Neuroscience 2022Quote: D-(+)-Glucose (G8270, CAS 50-99-7, Merck) in Perfusion Fluid CNS was used to prepare nanoESI-FTMS calibration samples ...
-
bioRxiv - Microbiology 2022Quote: ... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... anti-HA (HA-7, H3663, lot 066M4837V, Merck) 1/1,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Biophysics 2020Quote: 19) Potassium chloride (KCl, Merck, CAS # 7447-40-7)
-
bioRxiv - Microbiology 2021Quote: ... Cuttings were transferred in magenta GA-7 vessels (Merck), incubated at 28°C ...
-
bioRxiv - Immunology 2022Quote: ... mouse CC1 Anti-APC (Ab-7) (#OP80-100UG, Merck) and mouse anti-Olig2 (#66513-1-IG ...
-
bioRxiv - Neuroscience 2022Quote: ... n-amyl acetate (AM; CAS: 628-63-7, Merck) diluted 1:20 in paraffin oil (CAS ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... either n-amylacetate (AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7% FBS (BioWest) and 10μg/mL Blasticidin hydrochloride (Merck)45.
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Microbiology 2021Quote: ... Methyl viologen dichloride hydrate (paraquat, 98% purity) and Isopropil-β-D-1-tiogalactopiranósido (IPTG) were purchased from Merck.
-
bioRxiv - Molecular Biology 2020Quote: ... 7 were pooled together and concentrated to 1mL (UFC201024, Merck) and stored at −80°C.
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-HA-7 (Merck H9658; RRID:AB_260092; WB 1:20000) mouse anti-T7-tag (Merck 69522 ...
-
bioRxiv - Cell Biology 2020Quote: ... TE-7 (mouse, 1:200, Cat nb CBBL271, Merck, Sigma), Pax7 (mouse ...
-
bioRxiv - Neuroscience 2023Quote: ... inside a 7 mL KIMBLE Dounce tissue grinder set (Merck), using 10 strokes with loose pestle followed by 10 strokes with tight pestle ...
-
bioRxiv - Cancer Biology 2023Quote: ... and DEHP (1 µM, CAS no. 117-81-7, Merck) and the other was exposed by drinking water to the vehicle (absolute ethanol diluted at 1/106 in water) ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...