Labshake search
Citations for Merck :
51 - 100 of 1694 citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore, SLHV033RS). P2 virus was either propagated further or stored at 4ºC in the dark ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of Protein powder solutions (1 mg/ml) were added to 3 cm NG plates with 10 µM 5-FU (Merck, #F6627). After the plates had dried ...
-
bioRxiv - Bioengineering 2024Quote: ... or 3-5×105 pelleted cells were lysed in TRI Reagent (“LS” for fluid EV samples, conventional for cells, Merck Millipore). Liquid chloroform was added to the lysates at a 1:5 v/v ratio and vigorously mixed for 30 s ...
-
bioRxiv - Microbiology 2021Quote: ... protease cleavage site at the N-terminus site was subcloned between KpnI (5’-terminus) and HindIII (3’-terminus) restriction enzyme sites in the pRSF-1b vector (Merck, Darmstadt, Germany) to express His-TEV protease site-MA protein (pRSF-1b_MA ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 100 μL acetonitrile and rehydrated with 25 μL trypsin solution, containing 5 ng/μL trypsin (cat # 37283, SERVA Electrophoresis GmbH, Heidelberg) in 3 mmol/L ammoniumbicarbonate (cat # 09830, Merck KGaA, Darmstadt). After 4 h incubation at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... The blots were developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-brom-4-chlor-3-indoxylphosphate (BCIP; Merck, Darmstadt, Germany) for 5–30 min at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3% casein (Merck) in 20 mM TBS (pH 11.0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nutlin-3 (Merck) was dissolved in DMSO and diluted in saline.
-
bioRxiv - Microbiology 2022Quote: ... mice were gavaged with 0.2 ml of Fluorescein Isothiocyanate-Dextran (FITC-Dextran; 3–5 kDa; cat. no. FD4; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) in PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... The flow through and wash fractions were concentrated to 3-5 mg/mL using Amicon ultrafiltrators (10 kDa MWCO, Merck Millipore, Darmstadt, Germany). All fractions were combined and dialyzed 2x over night at 4 °C against 5 L 10 % (v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... 14-3-3 binding was detected using anti-GST monoclonal antibody (Merck).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 0.15% 3-[(3- Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, Merck Chemicals Ltd.). NADH:decylubiquinone (DQ) ...
-
bioRxiv - Genetics 2023Quote: ... and 5-methyltetrahydrofolate (5-MTHF, Merck, #M0132) were added to NMG media at indicated concentrations ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3% hydrogen peroxide (Merck) was applied to the sections prior to incubation with HRP-conjugated secondary antibodies for 1h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 µM TBTA (Merck), 3 µM Picolyl-Alexa647-Azide (Jena Bioscience ...
-
bioRxiv - Biophysics 2024Quote: ... 3 µM TBTA (Merck), 3 µM Picolyl-AF647-Azide (Jena Bioscience ...
-
bioRxiv - Microbiology 2020Quote: ... spores were collected from 5-day-old cultures NO3 medium (0.17% yeast nitrogen base, 3% sucrose, 100mM KNO3) by filtering through miracloth (Merck; pore size of 22–25μm). Spores were centrifuged ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed three times with DPBS for 5 minutes and incubated for 1 hour with respective secondary antibodies (Suppl. table 3) and DAPI (#10236276001; Merck Life Science, Dorset, UK) for nuclear counterstaining in 1% donkey serum ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... + 5% HS + 5% donkey serum (DS, Merck - D9663) at RT for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... we included αTIM-3+ αPD-1 and used anti-human RSV-IgG4 as an isotype control antibody (5 μg/mL, 60AGK S228P, Merck & Co., Inc., Rahway, NJ, USA). On day six ...
-
bioRxiv - Bioengineering 2021Quote: Three sender area squares (3 × 3 mm) were put into a 24-well containing 300 μL of anti-His antibody (Merck, Germany, NOVG70796-3) (10 μg mL−1 in DPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Microbiology 2021Quote: ... 3’-diaminobenzidine (DAB; Merck, Germany). DAB polymerizes in contact with H2O2 in the presence of peroxidase ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 (mouse monoclonal from Merck), GABA A Receptor γ (guinea pig polyclonal from SYSY) ...
-
bioRxiv - Microbiology 2022Quote: ... 3 gr/L (Merck, Germany); Na2HPO4 ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Microbiology 2020Quote: ... SU5402 3 μM (SML0443; Merck); and DAPT 10 μM (D5942 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM MgCl2 (#105833, Merck), 2 mM EGTA (Triplex®VI #108435 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 kDa MWCO (Merck - UFC500324) and 0.5 µl were injected to LC-MS system ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM Chiron (Merck #SML1046), 1 μM PD 0325901 (Merck #PZ0162) ...
-
bioRxiv - Immunology 2023Quote: ... and 3% H2O2 (Merck, 216763). Fresh bleaching solutions were prepared and slides were bleached two times (15 min each ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3% H2O2 (Merck – 216763). Fresh bleaching solutions were prepared ...