Labshake search
Citations for Merck :
51 - 100 of 4874 citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM sodium ascorbate) on ice and filtered through 2 layers of Miracloth (Merck Millipore). Intact chloroplasts were collected from a band at the interface between the 40 % (v/v ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% penicillin-streptomycin and 0.00035% 2-mercaptoethanol (Merck)) to an orbital shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of 1 M DTT (Merck, D9779) was added and the sample was heated for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... the MEK1/2 inhibitor PD0325901 (1 μM, Merck), LDN-193189 (100 nM ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of chloroform:isopropanol 2:1 (v:v)(Merck) were used to elute the neutral lipid fraction (NL) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 90% and 100% ethanol and 5 min in xylene/ethanol (1:1, Merck) and 5 min in xylene ...
-
bioRxiv - Cancer Biology 2020Quote: ... media was replaced with media containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
bioRxiv - Pathology 2023Quote: ... 1 µl of CAA (400mM 2-Chloroacetamide (#C0267, Merck) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... pericarp sections were incubated for 2 h in a 5% (v/v) Normal Donkey serum (NDS; Merck) blocking solution in MTSB ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... or 1-octanol was used (1-OCT; CAS: 111-87-5; Merck, Darmstadt, Germany; undiluted). Paraffin is without behavioural significance in larval Drosophila (Saumweber et al ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% streptomycin and 2 mM of Glutamax and 0.1 μg·ml−1 GDNF (#SRP3200, Merck) (Vyas et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... pH 7.4 (Carl Roth),125 mM KCl (Merck),1 mM MgCl2 (Merck),1 mM EGTA/KOH pH 8.0 (Carl Roth),5% glycerol (Merck),1% NP-40 (Nonidet P 40 Substitute ...
-
bioRxiv - Genomics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Genetics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked for 1 h with 5% skim milk (Merck) in TBST [50 mM Tris-HCL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were blocked for 1 hour with 5% BSA (Merck, #A3294) in T-BST at room temperature and incubated with primary antibodies (ETV6::RUNX1 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 nM β-estradiol and 2 μg/mL insulin (Merck). Any red blood and unattached cells were removed by media change within 18 hours ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Merck) was added for nuclear staining and incubated at room temperature for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse anti-centrin-2 (1:500 IF; 20H5) from Merck, mouse anti-CEP152 (1:1000 WB and 1:2000 IF ...
-
bioRxiv - Cell Biology 2022Quote: ... medium was replaced with the culture medium containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL lipid extract was injected on a LiChroCART 250–4 LiChrospher® Si 60 (5 μm) (Merck) maintained at 25 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... and Click-iT® EdU (5-ethynyl-2’deoxyuridine) Assay (BCK-EDU488, baseclick GmbH, Merck/Sigma-Aldrich, UK), respectively ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck), respectively ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 μM of the protease inhibitor 4-(2-aminoethyl)-benzolsulfonyfluorid hydrochloride (BioChemica) and 5 U/mL-benzonase (Merck) were added (final concentrations) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 U ml−1 penicillin and 50 μg ml−1 streptomycin (Merck Life Science (Sigma)) at 37 °C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by 5 min in a 1:1 mixture of propylene oxide (Fluka, Merck, Darmstadt, Germany) and SPURR (Low Viscosity Spurr Kit ...
-
bioRxiv - Microbiology 2024Quote: ... diluted 1:100 in PBS with 1% BSA and 2% Triton™ X-100 (Merck Life Science UK Limited ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... 1 nM 3,3′,5-Triiodo-L-thyronine sodium salt (Merck, cat. #T6397), and 1% penicillin-streptomycin (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... A solution of 5 g·L-1 bovine serum albumin (Merck-Sigma A9647) was used to construct a standard curve ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 2 % (vol/ vol) FCS and and 10 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, Merck) and cut into 1 cm pieces ...
-
bioRxiv - Cell Biology 2022Quote: ... the nuclei were visualized with Hoechst 33258 (Merck, B2883, 2 µg/ml in H2O at RT for 5 min).
-
bioRxiv - Microbiology 2022Quote: ... 5°6.7’ E) in September and October 2017 by filtering 2 L of seawater through PVDF membrane filters (Merck Millipore ...
-
bioRxiv - Biochemistry 2023Quote: ... The proteins were reduced utilizing a 5 mM solution of tris-2-carboxyethyl-phosphine (TCEP) (Merck KGaA, Darmstadt, Germany) at a temperature of 60 °C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... whose composition is as plating media but with 5% FBS and 2 μM cytosine β-d-arabinofuranoside (Merck, C6645) to limit glial growth ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mixture (2:1 v/v) of (PFA 4% (Merck, 104005) in PBS 1X pH7.4):OCT (Leica Surgipath ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (all Merck). The oxygen consumption rate (OCR ...
-
bioRxiv - Neuroscience 2021Quote: ... 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Merck, Darmstadt, Germany, 1 mM) dissolved in PBS was added to each well and the plate was placed in the dark for 10 min at room temperature for cell uptake ...
-
bioRxiv - Neuroscience 2020Quote: ... chicken anti-microtubule-associated protein 2 (MAP2; 1:2000; Chemicon/Merck), and guinea pig anti-vesicular glutamate transporter 1 (VGLUT1 ...
-
bioRxiv - Neuroscience 2024Quote: ... combined with rabbit anti- MAP-2 (Merck Millipore, #AB5622, 1:800), followed by goat anti-mouse Dylight405 (Jackson ImmunoResearch ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Merck), mounted (Aqua Poly/Mount ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were cultured in LHC9/RPMI 1640 (1:1) without serum as previously described51,52 supplemented with rho-associated protein kinase 1 inhibitor (Y-27632, Merck, 5 mM), SMAD-signaling inhibitors ...