Labshake search
Citations for Merck :
51 - 100 of 2626 citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 3 µM TBTA (Merck), 3 µM Picolyl-Alexa647-Azide (Jena Bioscience ...
-
bioRxiv - Biophysics 2024Quote: ... 3 µM TBTA (Merck), 3 µM Picolyl-AF647-Azide (Jena Bioscience ...
-
bioRxiv - Neuroscience 2022Quote: ... with a Chromolith® RP-18 endcapped 5-3 guard cartridges (Merck, Darmstadt, Germany), operated under a flow rate of 0.3 mL/min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by 3 PBS washes and blocking with 5% bovine serum albumin (BSA; Merck) for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies used were CYFIP1/2 (Sra-1/PIR121 [14], Rac1/3 (23A8, Merck), Nap1 [14] ...
-
bioRxiv - Neuroscience 2023Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay was used to analyze the cell viability of SH-SY5Y cells ...
-
bioRxiv - Cancer Biology 2024Quote: The 3-(4,5-dimethylthiazo1-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Merck Sigma, Burlington, MA) reduction assay was used to quantify cell proliferation ...
-
bioRxiv - Microbiology 2024Quote: ... and 300 nM 4′,6′-diamidino-2-phenylindole (DAPI) (Merck, Germany; #28718-90-3). Fluorescence signals were observed by an ECLIPSE TE2000-U fluorescence microscope (Nikon ...
-
bioRxiv - Microbiology 2024Quote: ... 2–3 mL of stock solution was applied to preparative TLC plates (glass, Merck, 20x20 cm ...
-
bioRxiv - Neuroscience 2021Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Neuroscience 2022Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Microbiology 2024Quote: ... polyethylene glycol was added to a final concentration of 5% (Cat # 25322-68-3, Merck), and a LFA strip (Cat # 3822-9000 ...
-
bioRxiv - Biochemistry 2020Quote: ... ethyl acetate p.a (Merck), KBr Pro spectrophotometry ...
-
bioRxiv - Immunology 2022Quote: [12C4]-ethyl acetoacetate (Merck) and [13C4]-ethyl-acetoacetate (Cambridge Isotope labs ...
-
bioRxiv - Bioengineering 2021Quote: Three sender area squares (3 × 3 mm) were put into a 24-well containing 300 μL of anti-His antibody (Merck, Germany, NOVG70796-3) (10 μg mL−1 in DPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Microbiology 2021Quote: ... 3’-diaminobenzidine (DAB; Merck, Germany). DAB polymerizes in contact with H2O2 in the presence of peroxidase ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 (mouse monoclonal from Merck), GABA A Receptor γ (guinea pig polyclonal from SYSY) ...
-
bioRxiv - Microbiology 2022Quote: ... 3 gr/L (Merck, Germany); Na2HPO4 ...
-
bioRxiv - Microbiology 2020Quote: ... SU5402 3 μM (SML0443; Merck); and DAPT 10 μM (D5942 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM MgCl2 (#105833, Merck), 2 mM EGTA (Triplex®VI #108435 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 kDa MWCO (Merck - UFC500324) and 0.5 µl were injected to LC-MS system ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM Chiron (Merck #SML1046), 1 μM PD 0325901 (Merck #PZ0162) ...
-
bioRxiv - Immunology 2023Quote: ... and 3% H2O2 (Merck, 216763). Fresh bleaching solutions were prepared and slides were bleached two times (15 min each ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3% H2O2 (Merck – 216763). Fresh bleaching solutions were prepared ...
-
bioRxiv - Immunology 2023Quote: ... BAM-15 (3 μM; Merck), rotenone (2 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM ATP (Merck, A2383), 2 mM GTP (Jena Bioscience ...
-
bioRxiv - Immunology 2024Quote: ... and 3% H2O2 (Merck, #216763,) for 3 rounds (15 mins each ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 mM MgCl2 (Merck, #7791186), 0.3% (vol/vol ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Plant Biology 2021Quote: Arabidopsis 14-3-3 isoforms Epsilon and Lambda were expressed using the pGEX-4T1 vector (Merck), as a translational fusion with glutathione-S-transferase (GST ...
-
bioRxiv - Cell Biology 2024Quote: ... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Cell Biology 2020Quote: ... and 1x phosphatase inhibitor 3 (Merck). Cell debris was removed by pelleting at 5000g for 10mins ...
-
bioRxiv - Immunology 2021Quote: ... 3-Methyladenine (3MA, 5mM; Merck Millipore) or Anakinra (500ng/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-mGluR2/3 (Merck Millipore), rabbit anti-CRTAC1 (Merck Millipore) ...
-
bioRxiv - Neuroscience 2022Quote: ... primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h ...