Labshake search
Citations for Merck :
901 - 950 of 3476 citations for Mouse Fibroblast Growth Factor Receptor 1 FGFR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed once and then incubated with the appropriate fluorescently labelled secondary antibody (anti-mouse polyvalent Ig-FITC (Merck) or anti-His6 HIS.H8 DyLight 488 ...
-
bioRxiv - Cancer Biology 2021Quote: ... blocked with 10% bovine serum albumin (BSA) 30 min at 37°C and incubated with primary anti-γH2A.X mouse antibodies (Merck Millipore) or rabbit anti-LC3B antibodies (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse LL/2 (LLC1; ATCC no. CRL-1642; obtained in 2015) was grown in BME with Earle′s salts (Merck) with the same supplementation as mentioned above ...
-
bioRxiv - Cell Biology 2022Quote: ... and SDS-PAGE and immunoblots were performed by standard methods using a mouse monoclonal anti-MYC antibody (clone 4A6, 05-724, Merck).
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following antibodies were used for ChIP analysis: Mouse anti-RNA polymerase II antibody clone CTD4H8 (Merck Millipore, 05-623), Rabbit anti-NF-kB p65 antibody clone D14E12 (Cell Signalling ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were run on SDS-PAGE and the expression of IDO1 was analyzed with a mouse anti-IDO1 antibody (clone 8G-11, Merck). Mouse monoclonal Ab against β-tubulin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
bioRxiv - Microbiology 2023Quote: ... the fixation procedure above with and without subsequent membrane permeabilization was used in infected/uninfected organoids that were then stained with a mouse monoclonal anti-mitochondria antibody Cy3 conjugate (Merck) incubated overnight at 4 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... CDK9 was immunoprecipitated with 15μg of an anti-CDK9 antibody (D-7, sc-13130, lot no # B1422) or control mouse IgG (12-371, Merck) in IP Buffer with 2X SDS buffer (100mM NaCl ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were incubated with secondary antibodies conjugated with PLA probes MINUS and PLUS: the PLA probe anti-mouse PLUS and anti-rabbit MINUS (Merck). Incubation with all antibodies was accomplished in a humidified chamber for 1 h at 37 °C ...
-
bioRxiv - Plant Biology 2021Quote: Multiple rounds of sequential extraction (initially by hexane/dichloromethane (1:1 v/v) (Merck, Germany ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:100 protease inhibitor cocktail and 1 mM Phenylmethylsulfonyl Fluoride (PMSF; all from Merck). Equal amounts of protein (40 μg ...
-
bioRxiv - Immunology 2021Quote: ... or 1 h with rabbit polyclonal anti-GAPDH antibody (1:3000, ABS16, Merck Millipore) followed by incubation with respective HRP-conjugated secondary antibodies (G21040 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... with secondary antibodies diluted in blocking solution with 1% Hoechst 33258 (1:100, Merck). After three times washing with PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% streptomycin and 2 mM of Glutamax and 0.1 μg·ml−1 GDNF (#SRP3200, Merck) (Vyas et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μl AAV virus was mixed with 1 μl 20% mannitol (MERCK K93152782 111). The virus and mannitol mixture were injected into a pulled-glass pipette (Warner Instruments ...
-
bioRxiv - Microbiology 2023Quote: ... phage stock was treated with 1 µL DNase I (10 U µL−1) (Merck) and 1 μL RNase A (10 U µL−1 ...
-
bioRxiv - Genetics 2023Quote: ... and crosslinked with 1% formaldehyde in PBS buffer containing 1 mM Pefabloc SC (Merck), Complete proteinase inhibitor cocktail (Merck) ...
-
bioRxiv - Microbiology 2023Quote: ... fixed cells were incubated with 1× PBS containing 1% bovine serum albumin (Merck KGaA) for 1 hour on ice ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 mM MgCl (Merck KGaA), pH 8.1) ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 mM MgCl (Merck KGaA), pH 8.1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 mM sodium pyruvate (Merck), and 50 mg/mL Kanamycin (BioConcept) ...
-
bioRxiv - Biophysics 2021Quote: ... and 1 % deoxycholic acid (Merck) in 50 mM Tris pH 8.0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 U/μl benzonase (Merck) was added ...
-
bioRxiv - Genetics 2021Quote: ... 1 mM Dithiothreitol (DTT, Merck), 0.5 mM Phenylmethanesulfonyl fluoride (PMSF ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX9 (1: 500, Merck, AB5535), LAMP3 (1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... proSFTPC (1:1000; Merck, AB3786), mature SFTPC (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-FAM21 (Merck, 1:1000), anti-phalloidin- TRITC (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... SOX9 (1: 1000, Merck, AB5535) and β-Actin (1 ...
-
bioRxiv - Cell Biology 2019Quote: Plk4 (1:250; Merck, MABC544)
-
bioRxiv - Biophysics 2020Quote: ... Thymidine (Merck, T1895, 1 mM) and Centrinone (Lucerna-Chem ...
-
bioRxiv - Developmental Biology 2021Quote: ... proSPC (1: 500, Merck, AB3786). After washing off the primary antibodies ...
-
bioRxiv - Cell Biology 2021Quote: ... ± Dox (1 µg/mL; Merck). Biotinylated antibodies and Anti-Biotin MicroBeads (Miltenyi ...
-
bioRxiv - Bioengineering 2020Quote: ... VGLUT1 (1:200, Merck, AMAB91041), rat monoclonal anti-Dopamine Transporter ...
-
bioRxiv - Bioengineering 2020Quote: ... Tuj1 (1:200, Merck, MAB1637), chicken polyclonal to tyrosine hydroxylase ...
-
bioRxiv - Cell Biology 2021Quote: ... actin (Merck, A2066, 1:4000). Secondary antibodies (all from Santa Cruz Biotechnology ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 mM PMFS (Merck, P7626), 1 mg/mL aprotinin (Carl-Roth ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked in 1% H2O2 (Merck) and incubated with 1 % normal Serum (Vector PK6200 ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked in 1% H2O2 (Merck) and incubated with 1% NGS (Normal Goat Serum ...
-
bioRxiv - Cell Biology 2020Quote: ... or Purmorphamine (1 μm, Merck) for 6 days ...
-
bioRxiv - Neuroscience 2022Quote: ... GAPDH (Merck, AB2302, 1:120,000). Densitometric analysis of protein bands was performed using Image Studio Lite Version 5.2 to derive band intensities which were then normalized to GAPDH.
-
bioRxiv - Cancer Biology 2022Quote: ... containing 1 mm EDTA (MERCK, Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% Amphotericin B (Merck, A2942) and 5 µg/ml Apo-Transferrine (Merck ...
-
bioRxiv - Molecular Biology 2022Quote: ... and GAPDH (1:10’000, Merck Millipore ...
-
bioRxiv - Cell Biology 2022Quote: ... FN (F3648, Merck, 1:400), Slug (clone (C19G7 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 unit/mL heparin (Merck), 0.2 μM H1152 (FUJIFILM Wako Pure Chemical Co.,) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-NFH (1:1000, Merck), anti-CCR7 (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1:500 EM48 (MAB5374, Merck), 1:100 ChAT (AB144P ...