Labshake search
Citations for Merck :
851 - 900 of 1100 citations for IL 5 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The formula was build based on a twofold serious dilution of glycerol (>/= 99% purification, Merck, cat # 56-81-5). The glycerol density (microgram glycerol/mg hyphal weight ...
-
bioRxiv - Microbiology 2023Quote: ... and SAM_Seq_Ex8_RV (5’-CTT CTT ATT GCC TCC TCT GGC ACA GC) together with KOD Hot Start DNA Polymerase (Merck) or KAPA HiFi HotStart ReadyMix ...
-
bioRxiv - Neuroscience 2023Quote: ... they were washed 3 times with 1X PBS for 5 minutes and incubated with DAPI (4’6-Diamidino-2-phenylindole; 1 µg/mL, MERCK) for 5 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Single colonies from those plates were inoculated in 5 mL of tryptic soy broth (TSB; Merck KGaA, Darmstadt, Germany) and incubated for 16 - 18 h at 37°C with shaking at 200 rpm ...
-
bioRxiv - Developmental Biology 2023Quote: ... rinsed for 5 min in water and then placed for 30 min in the Schiff reagent (Merck, Darmstadt, Germany). After three 2-min washes in water ...
-
bioRxiv - Immunology 2023Quote: Cells were infected separately with five different lentiviral transduction particles (at MOI = 5) containing five different shRNA species (Merck) specific for the mouse Flot2 gene (NM_008028 ...
-
bioRxiv - Biochemistry 2023Quote: ... The proteins were reduced utilizing a 5 mM solution of tris-2-carboxyethyl-phosphine (TCEP) (Merck KGaA, Darmstadt, Germany) at a temperature of 60 °C for 1 hour ...
-
bioRxiv - Biophysics 2023Quote: ... The onion cells were prepared by dissecting a 5 mm x 5 mm section of the abaxial epidermis from a brown onion and mounting the membrane (5 mm x 5 mm) onto a #1.5 coverslip with 100 µl of neat Lugol’s iodine solution (62650; Merck, Germany) to produce a stained specimen.
-
bioRxiv - Cancer Biology 2023Quote: Protein solutions were first diluted with 50 mM ammonium bicarbonate (ABC) and reduced with 5 mM dithiothreitol (DTT, Merck) at 60 °C for 45 min ...
-
bioRxiv - Neuroscience 2023Quote: ... LC-MS analysis was performed with a ZIC-pHILIC chromatographic column (5 µm, 2.1 × 150 mm, Merck, Darmstadt, Germany). Full scan positive and negative ionization modes with a resolution of 70.000 (FWHM ...
-
bioRxiv - Microbiology 2023Quote: ... Chromatographic separation was performed on a SeQuant ZIC-HILIC column (5 µm, 200 Å, 150 × 2.1 mm, Merck, Germany) equipped with a SeQuant ZIC-HILIC guard column (20 × 2.1 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 20 µL 5% w/v solution of polyvinyl alcohol (PVA; fully hydrolyzed, MW = 145000 Da; Merck Group, Darmstadt, Germany) in water with 50 mM sucrose was spread onto a 2 cm by 5 cm area corresponding to the dimensions of a rectangular ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Cancer Biology 2023Quote: ... Supernatants were then analysed by LC-MS by separating using hydrophilic interaction liquid chromatography with a SeQuant ZIC-pHILIC column (2.1 × 150 mm, 5 μm) (Merck). Analytes were detected with high-resolution ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Developmental Biology 2024Quote: ... Protein pellets were resuspended in 1x S-Trap lysis buffer (5% SDS, 50 mM TEAB from Merck, pH 8.5). 50 µg of the sample protein was digested using the S-trap micro spin column digestion protocol from ProtiFi LLC ...
-
bioRxiv - Microbiology 2024Quote: ... Chromatography was performed on an Agilent Infinity II 1290 HPLC system using a SeQuant ZIC-pHILIC column (150 × 2.1 mm, 5 μm particle size, peek coated, Merck) connected to a guard column of similar specificity (20 × 2.1 mm ...
-
bioRxiv - Microbiology 2024Quote: The chromatographic separation for metabolite profiling was performed using a SeQuant ZIC-pHILIC (2.1×100 mm, 5-μm particle) column (Merck) at 40°C ...
-
bioRxiv - Biochemistry 2024Quote: ... ROS quenching was carried out by treating cells with 5 mM N-acetyl cysteine (NAC) (616-91-1, Merck) for 1 h.
-
bioRxiv - Cell Biology 2020Quote: Epithelial canine MDCK II (CRL2936) cells were obtained from the ATCC and grown in MEM supplemented with 5% FBS (Merck) at 37°C in an atmosphere of 5% CO2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with FITC (Fluorescein isothiocyanate) conjugated secondary antibody (0.5 μg/ml of Goat Anti-Mouse IgG-FITC in 5%BSA) (GeNei, Merck, USA) (Cat.no ...
-
bioRxiv - Developmental Biology 2021Quote: ... they were washed again in PBS (three times, each for 5 min) and mounted with antifade solution (Cat.no. S7114, Sigmsa-Aldrich, Merck, USA). Images were acquired using a Leica DM 2500 fluorescent microscope (Leica ...
-
bioRxiv - Molecular Biology 2019Quote: RNA for each biological repeat was extracted from 110 mg of rosette leaves number 5-6 (from at least six plants) with TRI Reagent (Merck) and rounds of phenol-chloroform and chloroform extractions followed by isopropanol precipitation ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Developmental Biology 2022Quote: ... slides were incubated with a solution containing 1/50 phalloidin alexa fluor 488 in PBST supplemented with 5% DMSO (Merck) and covered with parafilm (Bemis ...
-
bioRxiv - Microbiology 2020Quote: ... 5×106 cells from treated and untreated conditions were centrifuged for 5 min at 4,500 g and the pellets were resuspended in 4% paraformaldehyde (PFA, Merck, Germany), and incubated for 20 min ...
-
bioRxiv - Microbiology 2019Quote: ... and bacterial pellets were resuspended in 5 ml of cold column buffer with 1x PIC (Protease inhibitor cocktail set I; Cat. Nr. 539131-10VL, Merck) and 200 mM PMSF (Cat ...
-
bioRxiv - Bioengineering 2019Quote: Fixed samples were centrifuged at 1,957 x g for 5 min at room temperature and re-suspended in cold Milli-Q water (Merck-Millipore) (4°C) ...
-
bioRxiv - Physiology 2021Quote: ... with 0.2 % m/v Triton-X100 and 5% Normal Goat Serum (m/v) (S26-LITER, Merck Life Science UK LTD) (PBST.NGS ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Cell Biology 2021Quote: ... HL-60 and MS-5 cells cultured alone and in co-culture were incubated for 24 hours in 50 μM H2O2 (Merck) complete cell culture medium ...
-
bioRxiv - Plant Biology 2021Quote: ... (+/-)-Abscisic acid (ABA, CAS No:14375-45-2), and Gibberellic acid (GA3, CAS No: 77-06-5) were purchased from Merck KGaA/ Sigma-Aldrich (Darmstadt ...
-
bioRxiv - Neuroscience 2020Quote: ... two custom-made Teflon containers of 5 mm diameter were filled with 10 μl of odor substance (n-amylacetate, AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Microbiology 2021Quote: ... Identification of metabolites for LC-MS was performed with a ZIC pHILIC column (150 mm × 4.6 mm, 5 μm column, Merck Sequant) coupled to high-resolution Thermo Orbitrap QExactive (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... chromatographic separation was performed on ZIC-pHILIC column equipped with a guard (5 µm, 4.6 × 150 mm, SeQuant®, Merck). The mobile phase (A ...
-
bioRxiv - Biophysics 2020Quote: ... 50 μL of sample was injected onto a Discovery BIO Wide Pore C18 column (15 cm x 4.6 mm, 5 μm column with a guard column) (Supelco, Merck, UK) and eluted on a gradient of 95% water + 0.1% acetic acid and 5% acetonitrile + 0.1% acetic acid to 5% water + 0.1% acetic acid and 95% acetonitrile + 0.1% acetic acid at a 0.8 mL/min flow-rate over 40 mins ...
-
miR-206 inhibits estrogen-induced proliferation and invasion of ER-α36 positive gastric cancer cellsbioRxiv - Cancer Biology 2021Quote: ... 20 μL of the MTT solution was added to each well (5 mg/ml, Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Then ...
-
bioRxiv - Cell Biology 2021Quote: ... against a final buffer (20mM Hepes, 200 mM NaCl, 5% Glicerol, 2mM DTT) and concentrated with appropriate MW cut-off Vivaspin columns (Merck). The concentration of purified proteins was determined by colorimetric assay (Bio-Rad DC Protein Assay ...
-
bioRxiv - Cell Biology 2021Quote: ... Spleen cells isolated from the mouse with the best serum titre were fused with Sp2/0 cells in the ratio of 5:1 using polyethylene glycol (PEG) 3000 (#817019, Merck). 10 million cells of the fusion mix were combined with 2x 104 BALB/c peritoneal macrophages and seeded in a 96-well plate ...
-
bioRxiv - Cell Biology 2021Quote: The samples were loaded onto a 5–20% gradient SDS-PAGE gel (Wako, Osaka, Japan) and transferred to an Immobilon-P Transfer Membrane (Merck). Antibodies were diluted with Signal Enhancer HIKARI for Western Blotting and ELISA (Nacalai Tesque) ...
-
bioRxiv - Microbiology 2022Quote: ... Separation in the HPLC was carried out using a SeQuant ZIC-pHILIC column (PEEK 150 × 2,1 mm, 5 μm, 110 Å, Merck) at 30 °C with an CH3CN (buffer A ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: HEK293T cells were cultured in 10 cm tissue culture treated dishes grown at 37 °C in a 5% CO2 atmosphere in HEPES buffered DMEM/F12 1:1 (Merck) supplemented with 10% fetal bovine serum and 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...
-
bioRxiv - Neuroscience 2020Quote: Cell-cycle kinetic differences were assessed by labelling cortical progenitor cells using a nucleotide analog 5-ethynyl-2’-deoxyuridine (EdU; Merck) in vivo following 150 □g EdU injection into the peritoneal cavity of pregnant mice 1 hour before the sacrifice of the embryos ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were incubated for 72h with the indicated concentrations of the respective drugs and further incubated for 3h with 5 mg/ml MTT (Merck). Finally ...
-
bioRxiv - Pathology 2019Quote: ... For MALDI-TOF/TOF/MS analysis dried peptides were dissolved in peptide resuspension solution (0.1% TFA in 5% ACN) and desalted/concentrated using C18 zip tips (Merck Millipore) as per the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Nuclei were pelleted by centrifugation at 3000 rpm for 5 min at 4°C and were resuspended in hypotonic buffer containing 1U/µl of benzonase (Merck). Extracts were incubated on ice for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... Chromatographic separation was achieved using a silica-based SeQuant ZIC-pHILIC column (2.1 mm × 150 mm, 5 µm, Merck, Germany) with elution buffers consisting of (A ...