Labshake search
Citations for Merck :
851 - 900 of 1258 citations for IL 3 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... The secondary horseradish peroxidase-coupled goat anti-mouse-IgG (AP124P, Merck Millipore, Darmstadt, Germany) for β-actin antibody was 10,000-fold diluted and goat anti-rabbit-IgG (81-6120 ...
-
bioRxiv - Biophysics 2020Quote: ... for 20 min and 1:500 dilution of mouse-Phospho-H2AX (Merck 05-636) antibody for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... and subsequently stained with primary antibodies: Mouse anti-FLAG (1:500) (monoclonal M2, Merck) or rabbit anti-myc (1:200 ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies used were: mouse anti-H2Ax pSer139 (γH2Ax; JBW301; 1:400 dilution; Merck) and rabbit anti-neurofilament (NF ...
-
The Vagus Nerve Mediates the Physiological but not Pharmacological Effects of PYY3-36 on Food IntakebioRxiv - Physiology 2020Quote: Mice were genotyped using the KAPA2G Fast HotStart Mouse Genotyping Kits (Merck, Southampton, UK) in a PCR ...
-
bioRxiv - Microbiology 2021Quote: Immunoglobulins in mouse sera were quantified using a Milliplex Multiplex assay (Merck Millipore, UK). Immunoglobulin beads (IgA ...
-
bioRxiv - Immunology 2021Quote: ... TILs were then stained with APC anti-mouse IFN-γ mAb clone XMG1.2 (MERCK) and PerCP-Cyanine5.5 anti-mouse TNF-α mAb clone MP6-XT22 (BioLegend) ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA from cell lines and mouse tumors was isolated using TRI Reagent (Merck), and total RNA from sorted cells was isolated using the RNeasy Micro Kit (Qiagen ...
-
bioRxiv - Physiology 2022Quote: Total RNA isolation from mouse tissues was performed with TRI-Reagent (Merck, Darmstadt, Germany). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: Mouse HL-1 cardiomyocytes (RRID: CVCL_0303) were cultured in Claycomb medium (Merck, Darmstadt, Germany) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... They were then incubated with mouse anti-phox2a (1:500, ref WH0000401M1-100UG, Merck) and a chicken anti-TH (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human kindlin2 (mouse monoclonal, 3A3, Merck, MAB2617; WB 1:1000, IF 1:200), anti-mouse kindlin2 (rabbit polyclonal ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used for immunofluorescence were mouse anti-centrin1 (Merck, #04-1624, 1:500), rabbit anti-STIL (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... and a biotinylated donkey antibody to mouse IgG (10 μg/ml; AP192B, Merck Millipore). The sections were further incubated with Alexa594-conjugated streptavidin (2.5 μg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Neuronal Nuclei (NeuN, mouse IgG1, 1:500, Merck Millipore, Burlington, MA, USA, MAB377); anti-Parvalbumin (PV ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6) or 1:200 anti-oxytocin receptor (polyclonal rabbit ...
-
bioRxiv - Neuroscience 2024Quote: ... The following antibodies were used: mouse anti-NP1 (OT staining; 1:2000; Merck; MABN844), rabbit anti-cfos (1:500 ...
-
bioRxiv - Biophysics 2024Quote: ... We utilized either the monoclonal anti-vinculin antibody produced in mouse (Merck, Ref: V9131) at 1:200 or the YAP monoclonal antibody (M01 clone 2F12 ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were incubated with the following antibodies: mouse monoclonal raised against eIF5A1 (SAB1402762, Merck), rabbit polyclonal raised against eIF5A2 (17069-1-AP ...
-
bioRxiv - Neuroscience 2024Quote: ... after which they were incubated in primary antibody (mouse anti-MBP 1:500, Merck NE1019 ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...
-
bioRxiv - Biophysics 2020Quote: ... 105 cells were seeded on the upper chamber of 24 well plate cell culture inserts containing 3 µm pores (Cat # 353096, Merck). The inserts were coated with rat-tail collagen I ...
-
bioRxiv - Cell Biology 2020Quote: ... Viruses were collected from the supernatant 24 hours later and cleared by centrifugation at 2000 rpm for 3 minutes followed by filtration with 0.45 µm PVDF syringe filter units (Merck, #SLHV033RS). Cleared supernatants were titrated by plaque assay using BHK-21 cells.
-
bioRxiv - Immunology 2021Quote: ... was mixed 1:1 and incubated at RT for 2-3 min or ECL substrate is added (Immobilon crescendo western HRP substrate, WBLUR0100, Merck). Membranes were then exposed to film and developed or visualised by chemiluminescence using the G:BOX Chemi gel doc Imaging System Instrument (Syngene) ...
-
bioRxiv - Microbiology 2019Quote: A sample (10 mL) was removed from the Gambierdiscus culture and filtered through 3-μm membrane (Merck Millipore, Darmstadt, Germany). One hundred microliters of the filtrate ...
-
bioRxiv - Evolutionary Biology 2020Quote: Larvae were raised as described above until 11 dpf and deeply anesthetized with 160 mg/l of Tricaine (Ethyl 3-aminobenzoate methanesulfonate salt, MS-222, Merck) before dissecting their pectoral fins ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were permeabilized with 0.1 % Triton-X100 in PBS for 20 min at RT and samples were blocked with freshly prepared 3 % bovine serum albumin (BSA, Merck) in PBS for 1 h at RT ...
-
bioRxiv - Molecular Biology 2021Quote: Heat-mediated antigen retrieval was performed for 3 min at 99°C in a 40mM trisodium citrate (Merck, Darmstadt, Germany) solution ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Neuroscience 2021Quote: Viability of SH-SY5Y cells after treatments with or without H-LIPEF was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Neuroscience 2019Quote: ... The HiTrap SP elution fractions containing the Tau proteins were concentrated using a 30 MWCO (for full length tau) or 3 MWCO (for tau fragments) Amicon centrifugal filter unit (Merck) and loaded on a HiLoad 16/600 Superdex 75 pg size exclusion chromatography column (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... After incubation cells were washed 3 times with PBS containing 0.5% BSA and subsequently fixed 1% (w/v) paraformaldehyde (PFA, Merck Millipore) in PBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... the collagenase inhibitor Ilomastat ((R)-N′-Hydroxy-N-[(S)-2-indol-3-yl-1-(methylcarbamoyl)ethyl]-2-isobutylsuccinamide) (25μM, CC1010, Merck Millipore) or a combination of both ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... Chromatographic separation of AAs was achieved by applying 3 μl of dissolved sample on a SeQuant ZIC-HILIC column (3.5 μm particles, 100 × 2.1 mm) (Merck, Darmstadt, Germany), combined with a Javelin particle filter (Thermo Scientific ...
-
bioRxiv - Bioengineering 2021Quote: The rat INS-1 832/3 cell line (insulinoma cell line stably transfected with human insulin; hereinafter INS-1) was obtained from Merck. A HUVEC (human umbilical vein endothelial cell ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Cell Biology 2021Quote: Cells were sonicated at low power for 3 s and loaded onto a commercial microfluidics system (Y04C-02 plates, CellASIC ONIX2 system, Merck). While loading the cells ...
-
bioRxiv - Biochemistry 2020Quote: ... each N-Cdh sample was desalted against PBS using Amicon centrifugal filters with a 3 kDa molecular weight cutoff according to the manufacturer’s protocol (Merck-Millipore). Unprocessed xCGE-LIG N-glycocomics raw data are available upon request.
-
bioRxiv - Bioengineering 2021Quote: ... 99%+, Figure S1(d)), and dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP, 42% solution in methanol) were obtained from Merck–Sigma Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 100 μL aliquots were removed and the reaction was stopped using a 3 KDa nominal molecular weight limit (NMWL) centrifuge filter (Merck Amicon Ultra 0.5mL Centrifugal Filters ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Major peaks were desalted by RP-HPLC using an Ascentis C18 column (3 μm, 4.6mm ID x 15 cm, Sigma-Merck, Germany) using peak-based collection (slope) ...
-
bioRxiv - Systems Biology 2020Quote: ... The resultant pellets were resuspended in 3% acetonitrile + 0.1% trifluoroacetic acid and peptide quantification performed using the Direct Detect system (Merck Millipore). Protein samples were normalized then vacuum concentrated in preparation for mass spectrometry.
-
bioRxiv - Cell Biology 2020Quote: ... Cell medium was replaced with 3 mL medium containing 20 μL of the purified lentivirus and 3μl polybrene transfection reagent (Merck Millipore). Medium was supplemented with 10 µg/mL puromycin for selection of successfully transduced cells two to three days after transduction.
-
bioRxiv - Biochemistry 2022Quote: ... The purified proteins were concentrated to 2 mg/mL using centrifugal filters with either 3 kDa or 30 kDa cut-off (Amicon Ultra-0.5, Merck/Millipore) and the samples were centrifuged at 100,000 g ...
-
bioRxiv - Cell Biology 2022Quote: ... The remaining media was then concentrated down to 500 uL using a falcon tube sized 3 kDa amicon column (UFC900308; Merck) spun at 4000 xg and 4°C for approximately 1 h ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Bioengineering 2022Quote: ... 100 nM of RNA polyhedra samples folded in TE/Mg2+/Na+ buffer were concentrated four times using 3 kDa MWCO Amicon Ultra centrifugal filters (Merck). 5 µl of the concentrated sample was applied on 300 mesh Cu grids coated with lacey carbon (Agar Scientific) ...
-
bioRxiv - Biochemistry 2022Quote: ... Chromatography was performed on a zwitterionic (ZIC) column with phosphocholine phase (ZIC-cHILIC, 2.1 mm i.d. x 150 mm, 3 μm; Merck SeQuant, Sweden) [38] ...
-
bioRxiv - Genetics 2021Quote: ... At day 10 cells were passaged at a 2:3 ratio into 12 well cell culture plates coated with 15 µg/ml human plasma fibronectin (Merck) in Dulbecco’s phosphate-buffered saline (DPBS ...