Labshake search
Citations for Merck :
851 - 900 of 5411 citations for 7 chloro 1 2 diethylamino ethyl 5 2 fluorophenyl 1 3 dihydro 2H benzo 1 4 diazepin 2 one monohydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... with Pellicon 2 mini cassettes (300 kDa, 0.1 m2, BioMax polyethersulfone membrane with C-screen; Merck), as previously described (4) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were plated at a density of 100,000cm-2 in 96 well plates (Corning, MERCK UK), with wells previously coated for 24h with 20μg/ml FHL-1 ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 hours at 37°C and purified using a Amicon 30 kDa MWCO filter (Merck). Deep Vent exo-DNA polymerase (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 µl were spotted onto a thin layer chromatography (TLC) plate (PEI Cellulose F; Merck Millipore) pre-spotted with 2 µl of nucleotide mix containing AMP ...
-
bioRxiv - Biochemistry 2019Quote: All proteins were expressed in E.coli Rosetta-2 DE3 cells (EMD Millipore, Merck KGaA, Darmstadt, Germany). Cells were transformed via heat shock (42°C for 35 secs ...
-
bioRxiv - Immunology 2021Quote: ... The left lung was inflated with 0.6mL PBS/2% (w/v) low melting point agarose (Merck) in PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... the membranes were blocked with 2% BSA in PBS with 0.1% Tween-20 (Merck; blocking buffer) and incubated with primary antibodies diluted in blocking buffer overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in serum-free MEM supplemented with 2 µg/mL TPCK-treated trypsin (Merck) for 2 days at 37 °C in 5 % CO2 ...
-
bioRxiv - Immunology 2020Quote: ... cells were resuspended at a concentration of 10×106/100μL in PBS containing 2% FCS (Merck). Staining for cell surface antigens was performed for 20 minutes at 4°C in the dark ...
-
bioRxiv - Bioengineering 2022Quote: ... and LX-2 cells were labeled with a PKH67 Green Fluorescent Cell Linker Kit (Merck, PKH67GL) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2022Quote: ... Purified cells were cultured into organoids and treated with 2 μg/ml doxycycline (DOX, Merck, D9891) and 10 μM trimethoprim (TMP ...
-
bioRxiv - Neuroscience 2023Quote: ... Non-adherent cell culture plates were prepared with poly(2-hydroxyethyl methacrylate) (poly-HEMA; P3932, Merck) coating ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells have been lysed using 2× Laemmli buffer supplied with 100mM DTT (Dithiothreitol, Merck Sigma Aldrich), boiled at 95°C for 10min and then DNA was sheared by sonication (Bioruptor® Pico ...
-
bioRxiv - Biochemistry 2023Quote: ... in 30% (2-Hydroxypropyl)-β-cyclodextrin (HPβCD) or Sulfobutylether-β-Cyclodextrin (SBEβCD) (Sigma Aldrich, Merck, Germany). When tumors reached a size of 60-100 mm3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... During day 13 to 15 they were treated with 2 pulses of 3μM CHIR99021 (Merck, 361571) to dorsalise the tissue ...
-
bioRxiv - Developmental Biology 2023Quote: ... 25 μl of 2 mg/ml of 5ʹ-nucleotidase (snake venom from Crotalus atrox; Merck KGaA) in 0.1 M Tris-HCl pH 8.0 were added ...
-
bioRxiv - Molecular Biology 2023Quote: pCold-DDX43 and pCold-DDX6 were transformed into Rosetta 2 (DE3) competent cells (Merck Millipore/Novagen). The cells were cultured at 37°C until the OD600 reached ∼0.6 ...
-
bioRxiv - Physiology 2023Quote: ... an amount of 2 g/kg body weight D-glucose (20% solution in PBS+/+, Merck, USA) was injected ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mL of supernatant containing viral particles was harvested and filtered with 0.45 μm filter (Merck). Supernatant was immediately used for transduction or stored at -80°C in aliquots.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Human Caco-2 colorectal adenocarcinoma cells (1.7×105 cells/cm2) were cultured in DMEM medium (Merck) containing 10% FCS at 37°C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were incubated with following primary antibodies at 4 °C overnight: TRA-1-60 (Merck Millipore), OCT3/4 (H-134 ...
-
bioRxiv - Developmental Biology 2021Quote: ... iPSC-derived mesodermal cells were fed with basal medium supplemented with 4 μM IWR-1 (Merck) for 48 h ...
-
bioRxiv - Neuroscience 2021Quote: ... or Cy5-conjugated secondary antibodies (1:200; AP192SA6; Merck Millipore, USA; 17 hrs at 4°C). Similar immunolabeling steps were followed for the subsequent sequential staining ...
-
bioRxiv - Immunology 2020Quote: ... BJ-5at fibroblasts were kept in a 4:1 mixture of the Dulbecco’s Medium (Merck, #D6429) and Medium 199 (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... 150,000 to 200,000 HEK293-EBNA cells were plated in 1 mL complete DMEM per well of 12-well cell culture plates (#665180, Greiner bio-one, Merck KGaA). After 24 h ...
-
bioRxiv - Plant Biology 2020Quote: Inflorescences were harvested into fresh fixative (3:1 96% [v/v] ethanol [Merck] and glacial acetic acid) and kept overnight (O/N ...
-
bioRxiv - Biochemistry 2022Quote: ... and concentrated to 13.7 mg·ml-1 (A280=23.36) using a centrifugal filter (Amicon Ultra-0.5, MWCO 3 kDa, Merck Millipore) prior to crystallization ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 % (w/v) Bovine serum albumin and 3 % (v/v) goat serum (Merck Life Science cat. G9023). Following blocking ...
-
bioRxiv - Immunology 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Bioengineering 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APTS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Genomics 2024Quote: ... Traps deployed by BCC were also baited with 1-octen-3-ol (Merck Life Science, Bayswater, Australia) (van Essen et al. ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Neuroscience 2019Quote: ... rat anti-mouse VCAM-1 (Merck, cat.# CBL-1300, 1:100), rat anti-mouse ICAM-1 (Abcam ...
-
bioRxiv - Biophysics 2020Quote: ... RNAse A (1 mg ml−1, 10 min, 21°C, Merck) or DNAse (200 Units well−1 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... goat anti-Rabbit IgG-HRP (1:1000-1:3000, Merck Millipore) and goat anti-Mouse IgG-HRP (1:1000-1:3000 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... goat anti-Rabbit IgG-HRP (1:1000-1:3000, Merck Millipore) and goat anti-Mouse IgG-HRP (1:1000-1:3000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... lysates were clarified by centrifugation at 12000g and incubated 2h at 4°C with pre-equilibrated α-FLAG M2 affinity gel beads (Merck-Sigma, A2220). Beads were washed three times with lysis buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... permeabilized in 1% DMSO/1% Triton X-100 and stained with anti-phospho H3 antibody (1:250, Merck Millipore) followed by anti-rabbit Alexa 488 secondary antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 µL lysis buffer (15 mM NaHEPES pH 7.3, 30 mM NaCl, 1 mM MgCl2, 1% Brij35, 1 U/µL benzonase (Merck), 1X complete protease inhibitor (EDTA-free ...
-
bioRxiv - Biochemistry 2023Quote: ... was incubated in 5 mM Tris-HCl buffer (pH 7.5) containing each substrate (1% glucomannan, Neogen, MI, USA; 1% polygalacturonic acid, Neogen; 1% carboxymethyl cellulose, Merck; 1% soluble starch ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 50 μL magnetic beads were incubated with 5 μg of Ago-1 antibody (Merck, Millipore, Germany) or IgG antibody (Merck ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... For removal of chorion embryos were incubated for 5 mins with 1 mg/ml Pronase (Merck) then washed with culture medium and flash-frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... and then treated with one mL of bleaching solution [Water + 4% NaOCl (Merck) +1N NaOH (HiMedia ...
-
bioRxiv - Physiology 2023Quote: ... Blots were washed 3 x for 7 min with TBS-T (200 mM Tris (Merck), 1.36 mM NaCl (Merck) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50 mM EDTA) with 1 µl lyticase (17 U/ µl in 10 mM KPO4 pH 7, 50% glycerol, Merck >2000 U/mg L2524), heated to 50°C for 2 min before addition of 40 µl molten CleanCut agarose (Bio-Rad 1703594) ...
-
bioRxiv - Neuroscience 2020Quote: ... Blots were washed and probed with secondary antibody for one hour at RT (anti-mouse IgG, horseradish peroxidase linked; 1:5,000; Merck, Burlington, MA, USA). Bands were visualized using high sensitivity Pierce ECL Plus (Thermo Scientific ...