Labshake search
Citations for Merck :
801 - 850 of 3665 citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Ferrets were euthanized by intravenous injection of 1 ml of Beuthanasia-D diluted 1:1 with DI water (Merck, Madison, NJ). For determination of ferret ID50 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-Glut1 (1:100, 07-1401, Merck Millipore; and 1:400, MABS132, Sigma); anti-Fibronectin (1:600 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated for 1 hour with mEM48 (1:500, Merck Millipore, MAB5374) antibody at room temperature in TBS containing 0.1% TritonX-100 (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... Part 1 of the precursor solution contained 20 mg mL-1 fibrinogen (Merck) diluted in DMEM/F12 with HEPES ...
-
bioRxiv - Developmental Biology 2023Quote: ... they were incubated in 100 μg/mL DNAse 1 (1 mg/mL, Merck) in a concentration of 1000 cells/μL for 15 mins at RT ...
-
bioRxiv - Immunology 2023Quote: ... were either immersed in a 1:1 mixture of 30% hydrogen peroxide (Merck) and concentrated sulfuric acid (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... at 1:500 dilution and nuclear stain DAPI (1 μg/ml, Merck, D9542) at 4°C with gentle rocking ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... 90% and 100% ethanol and 5 min in xylene/ethanol (1:1, Merck) and 5 min in xylene ...
-
bioRxiv - Bioengineering 2023Quote: Two lipids (18:1-18:0 PC, 18:0-18:1 PC) (Merck) and stored at -20°C until sample preparation ...
-
bioRxiv - Cell Biology 2023Quote: ... at 1:2000 and/or DAPI (at 1:1000, ready-made solution, Merck).
-
bioRxiv - Biochemistry 2024Quote: ... were incubated for 45 min at 4°C with 10 µL agarose beads using a RAS-GTP pull-down assay kit (RAS Activation Assay Kit, Merck Millipore, 17-218). Supernatant was recovered after centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were pre-treated with (1) 36 µl of Lysozyme [1% w/v in 1% PBS – 37°C/30min with intermittent shaking] (Merck KGaA, Germany) and then with (2 ...
-
bioRxiv - Neuroscience 2022Quote: Small and large intestines were dissected from E14 embryos and digested with 1 mg/ml DNAse 1 (AppliChem A3778) and 1 mg/ml collagenase A (Merck Millipore 10103586001) in DMEM-F12 at 37 °C while shaking ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were incubated for 1 hour with 1% BSA blocking solution containing DAPI at 1:4,500 (Merck Life Sciences, Cat #: D9542), phalloidin at 1:350 (Merck Life Sciences ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with FITC (Fluorescein isothiocyanate) conjugated secondary antibody (0.5 μg/ml of Goat Anti-Mouse IgG-FITC in 5%BSA) (GeNei, Merck, USA) (Cat.no ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary antibodies were detected with HRP-conjugated anti-rabbit or anti-mouse IgG and visualised with Immobilon Western HRP substrate (Merck).
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed once and then incubated with the appropriate fluorescently labelled secondary antibody (anti-mouse polyvalent Ig-FITC (Merck) or anti-His6 HIS.H8 DyLight 488 ...
-
bioRxiv - Cancer Biology 2021Quote: ... blocked with 10% bovine serum albumin (BSA) 30 min at 37°C and incubated with primary anti-γH2A.X mouse antibodies (Merck Millipore) or rabbit anti-LC3B antibodies (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse LL/2 (LLC1; ATCC no. CRL-1642; obtained in 2015) was grown in BME with Earle′s salts (Merck) with the same supplementation as mentioned above ...
-
bioRxiv - Cell Biology 2022Quote: ... and SDS-PAGE and immunoblots were performed by standard methods using a mouse monoclonal anti-MYC antibody (clone 4A6, 05-724, Merck).
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following antibodies were used for ChIP analysis: Mouse anti-RNA polymerase II antibody clone CTD4H8 (Merck Millipore, 05-623), Rabbit anti-NF-kB p65 antibody clone D14E12 (Cell Signalling ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were incubated with secondary antibodies conjugated with PLA probes MINUS and PLUS: the PLA probe anti-mouse PLUS and anti-rabbit MINUS (Merck). Incubation with all antibodies was accomplished in a humidified chamber for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were run on SDS-PAGE and the expression of IDO1 was analyzed with a mouse anti-IDO1 antibody (clone 8G-11, Merck). Mouse monoclonal Ab against β-tubulin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
bioRxiv - Microbiology 2023Quote: ... the fixation procedure above with and without subsequent membrane permeabilization was used in infected/uninfected organoids that were then stained with a mouse monoclonal anti-mitochondria antibody Cy3 conjugate (Merck) incubated overnight at 4 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... CDK9 was immunoprecipitated with 15μg of an anti-CDK9 antibody (D-7, sc-13130, lot no # B1422) or control mouse IgG (12-371, Merck) in IP Buffer with 2X SDS buffer (100mM NaCl ...
-
bioRxiv - Plant Biology 2024Quote: ... Phosphorylated SR proteins were detected using a mouse monoclonal α-pan-phosphoepitope SR-specific antibody (1H4, Merck, Catalogue-No.: MABE50) at 0.025 µg/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned the cytoplasmic domain of AChRα (mouse; amino acid 317-428) with or without mCherry into pGEX-4T1 (Cytiva 28-9545-49; Merck). GFP-SH3BP2 with or without the intrinsic disorder domain (amino acid 164-449 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Chromatin immunoprecipitation was performed using 5-10 μg of primary mouse monoclonal ANTI-FLAG® M2 antibody (Merck, F1804-200UG) in 250 μL LB3 with 1% Triton X-100 overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... the culture was stimulated by substituting one third of the medium with L929 medium (L929 mouse fibroblast cells had previously been plated in T175 cm2 cell culture flasks (Corning, Merck) with 100 mL culture medium (DMEM ...
-
bioRxiv - Plant Biology 2021Quote: Multiple rounds of sequential extraction (initially by hexane/dichloromethane (1:1 v/v) (Merck, Germany ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:100 protease inhibitor cocktail and 1 mM Phenylmethylsulfonyl Fluoride (PMSF; all from Merck). Equal amounts of protein (40 μg ...
-
bioRxiv - Immunology 2021Quote: ... or 1 h with rabbit polyclonal anti-GAPDH antibody (1:3000, ABS16, Merck Millipore) followed by incubation with respective HRP-conjugated secondary antibodies (G21040 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... with secondary antibodies diluted in blocking solution with 1% Hoechst 33258 (1:100, Merck). After three times washing with PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% streptomycin and 2 mM of Glutamax and 0.1 μg·ml−1 GDNF (#SRP3200, Merck) (Vyas et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μl AAV virus was mixed with 1 μl 20% mannitol (MERCK K93152782 111). The virus and mannitol mixture were injected into a pulled-glass pipette (Warner Instruments ...
-
bioRxiv - Genetics 2023Quote: ... and crosslinked with 1% formaldehyde in PBS buffer containing 1 mM Pefabloc SC (Merck), Complete proteinase inhibitor cocktail (Merck) ...
-
bioRxiv - Microbiology 2023Quote: ... phage stock was treated with 1 µL DNase I (10 U µL−1) (Merck) and 1 μL RNase A (10 U µL−1 ...
-
bioRxiv - Microbiology 2023Quote: ... fixed cells were incubated with 1× PBS containing 1% bovine serum albumin (Merck KGaA) for 1 hour on ice ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we followed Magna-Chip™ A/G kit (from Merck) protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... ApopTag plus peroxidase in situ apoptosis detection kit (Merck Millipore) was used according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2019Quote: Plasma insulin was determined using a commercial kit (Merck Millipore) on a MAGPIXTM Multiplex reader and processed using Bio-Plex ManagerTM MP.
-
bioRxiv - Bioengineering 2021Quote: Bromocresol Purple (BCP) Albumin Assay Kit (Sigma-Aldrich, Merck, Germany) performed as per manufacturer’s instructions with plasma samples diluted 5-fold in ultrapure water ...
-
bioRxiv - Microbiology 2021Quote: ... following staining with a Gram stain kit (Merck, Darmstadt, Germany).
-
Large-scale conformational changes of FhaC provide insights into the two-partner secretion mechanismbioRxiv - Biophysics 2022Quote: ... the ECL kit of Amersham (Merck, St Quentin-Fallavier, France) and the Amersham Imager 600 (GE ...
-
bioRxiv - Developmental Biology 2022Quote: ... the ApopTag Red In Situ Apoptosis Detection Kit (Merck, S7165) was used ...