Labshake search
Citations for Merck :
801 - 850 of 5339 citations for Ethyl 2 pyrrolidin 2 yl 2 3 dihydro 1 3 thiazole 4 carboxylate hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... then 2% w/v Aspegillus niger pectinase (Merck Life Science UK Ltd., Gillingham, UK) 45°C for 2 hours ...
-
bioRxiv - Biophysics 2023Quote: Snap-Streptavidin-WA-His (pETplasmid) was expressed in Rosetta 2 (DE3) pLysS (Merck, 71403). Culture was grown in TB medium supplemented with 30 µg/ml kanamycin and 34 µg/ml chloramphenicol ...
-
bioRxiv - Developmental Biology 2023Quote: ... except for a different set of SYBR green primers (Sigma Merck, Supplementary Table 2). The obtained Ct values were analyzed using the ddCt method for relative quantification of mRNA expression derived from three independent experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... CaCo-2 cell lines were cultivated in Minimum Essential Medium Eagle (MEM) (Merck, M4655) complemented with 20% FBS Tetracycline free ...
-
bioRxiv - Molecular Biology 2023Quote: ... The eluted samples were concentrated using an Amicon Ultra-2 centrifuge filter unit (Merck) and stored on ice.
-
bioRxiv - Cell Biology 2023Quote: ... and concentrated to 65 µL using Amicon Ultra-2 10K filters (Merck Life Science).
-
bioRxiv - Biophysics 2022Quote: Snap-Streptavidin-WA-His (pETplasmid) was expressed in Rosettas 2 (DE3) pLysS (Merck, 71403). Culture was grown in TB medium supplemented with 30 μg/mL kanamycine and 34 μg/mL chloramphenicol ...
-
bioRxiv - Neuroscience 2023Quote: ... concentrated using 100 kDa-MWCO Centricon plus-20 and Centricon plus-2 (Merck-Millipore), aliquoted and stored at -80°C ...
-
bioRxiv - Biochemistry 2024Quote: Total ROS levels quantification was carried out using 2′,7′-dichlorofluorescein diacetate (H2DCFDA; Merck) assay ...
-
bioRxiv - Immunology 2024Quote: Resistance across the ALI was measured with a Millicell ERS-2 Voltohmeter (Merck Millipore) on days 10 ...
-
bioRxiv - Genomics 2024Quote: ... 2% (v/v) FCS supplemented with 10 mM ROCK inhibitor (Y-27632 (Merck, Y0503)) while shaking at 4°C for 20 minutes ...
-
bioRxiv - Synthetic Biology 2024Quote: The cell suspension was diluted with Overnight Express OnEx system 2 (Cat#71300, Merck) medium supplemented with 2.5 g/L PET nanoparticles and 200 μg/ml ampicillin ...
-
bioRxiv - Biophysics 2024Quote: ... the enzyme was desalted with Amicon® Ultra 2 ml centrifugal filters (Merck Millipore) to replace the existing buffer with the assay buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Colonies were stained using crystal violet solution (2% (w/v) crystal violet (Merck, UK) dissolved in 20% (v/v ...
-
bioRxiv - Biophysics 2024Quote: ... HeLa cells were treated with 2 μM cytochalasin D (CytoD) (Sigma-Aldrich/Merck, #C8273) under serum-starved conditions for 1 hour ...
-
bioRxiv - Biophysics 2024Quote: ... the cells were treated with 2 μM cytochalasin D (CytoD) (Sigma-Aldrich/Merck, #C8273) for 1 hour ...
-
bioRxiv - Biophysics 2020Quote: GMPCPP-stabilized microtubules were grown using a mixture of 1.3 mg ml−1 tubulin and 2 mM GMPCPP (Merck, NU-405L) in BRB80 and incubated for 1 hour (stepping and photobleaching assay ...
-
bioRxiv - Neuroscience 2021Quote: ... The brains were removed and post-fixed for 1-2 days and then transferred to 30% sucrose (Merck KGaA, Darmstadt, Germany) dissolved in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... All samples were further concentrated to a final volume of 1-2 ml using 100 kDa Amicon-ultra filters (Merck Millipore).
-
bioRxiv - Cell Biology 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 10 kDa ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were subsequently washed with PBS and incubated for 2 h with the proper secondary antibodies (1:300, goat anti-rabbit Alexa-Fluor® 647, AP187SA6, Merck Millipore ...
-
bioRxiv - Paleontology 2020Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Biochemistry 2020Quote: ... The lipids were resuspended in a small volume of chloroform/methanol (2:1) and applied to a to HPTLC plate (Silica Gel 60, Merck, Germany) together with DOPC/cholesterol and NeuGc/NeuAc GM3 as standards ...
-
bioRxiv - Microbiology 2020Quote: ... and the other stored at −80 °C in a sterile 2 ml cryovial containing 1 ml of a 30 % glycerol solution, prepared by diluting glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 5,000 Da ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Plant Biology 2023Quote: ... and concentrated to 2 mg chlorophyll mL-1 using a 100-kDa molecular-weight cut-off centrifugal filter unit (Amicon Ultra-15, Merck Millipore). A 3 µl volume of the sample was applied to a glow-discharged holey carbon grid (GIG ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfectants with stably integrated GOI were then selected based on their resistance to G418 (0.5 mg/ml, 1-2 weeks, Merck, Cat.N. G8168). To induce the expression of the GOI the cells were treated with doxycycline (2 μg/ml ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The routinely used growth medium was composed of yeast extract (1%(w/v)) (Fisher BioReagents™) and casein peptone (2%(w/v)) (Merck), and was supplemented with 2% (w/v ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 million cells per mL were suspended in 1 mL of a 1.2% sodium alginate solution (Merck, Saint-Quentin-Fallavier, France). Beads were formed by dripping the cell suspension into a sterile 100 mM CaCl₂ solution (VWR ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Cell Biology 2023Quote: ... Subsequently proteins were precipitated on magnetic carboxylate modified beads (Merck, GE45152105050250) in the presence of 77% (vol/vol ...
-
bioRxiv - Cell Biology 2023Quote: ... cell lysates were precipitated on magnetic carboxylate modified beads (Merck, GE45152105050250) in the presence of 77% (volv/vol ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sera-Mag SpeedBead Carboxylate-Modified Magnetic Particles (Hydrophobic) (#GE24152105050350, Merck) for 10mins at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...