Labshake search
Citations for Merck :
801 - 850 of 4549 citations for 8 CHLORO 2 METHYL IMIDAZO 1 2 A PYRIDINE 3 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and counterstained with Fast Green (0.04% w/v in 1% acetic acid, Merck, Darmstadt, Germany).
-
bioRxiv - Genetics 2022Quote: ... or SD complete amino acid agar (0.67% yeast nitrogen base with amino acids (Merck), 2% glucose ...
-
bioRxiv - Molecular Biology 2023Quote: ... To deplete Xrn1 and Dcp2 with the AID tags (Nishimura et al., 2009; Morawska and Ulrich, 2013) 1-Naphthaleneacetic acid (1-NAA; N0640-25G, Merck) was added to a final concentration of 1 mM ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and formic acid from Merck were used for HPLC separations ...
-
bioRxiv - Physiology 2022Quote: ... Phosphomolybdic Acid Orange G (Merck AG ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.01% pluronic acid (Merck) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 14% acetic acid (Merck). Plates were washed in water ...
-
bioRxiv - Physiology 2019Quote: ... ethylenediaminetetraacetic acid (EDTA) from Merck.
-
bioRxiv - Biochemistry 2019Quote: ... and glacial acetic acid (Merck) (v/v 85:15 ...
-
bioRxiv - Microbiology 2020Quote: ... propionic acid (Merck, Darmstadt, Germany), n-valeric acid (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Pure oxalic acid (Merck, Germany) was identified by the retention time and was quantified by an external standard curve ...
-
bioRxiv - Microbiology 2022Quote: ... L-lactic acid (~90%, Merck), ethanol and glycerol were added to final concentrations of 40 mM ...
-
bioRxiv - Physiology 2022Quote: ... water and formic acid (Merck) in different proportions ...
-
bioRxiv - Cell Biology 2023Quote: ... and L-ascorbic acid (Merck) supplemented with FGF2 (4 ug/mL ...
-
bioRxiv - Immunology 2023Quote: ... and concentrated sulfuric acid (Merck) for at least 30 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Linolenic acid (L2376-500MG, Merck), L-Carnitine hydrochloride (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 150 µM ascorbic acid (Merck), 55 µM β-mercaptoethanol (Thermo Fisher) ...
-
bioRxiv - Genetics 2023Quote: ... folic acid (FA, Merck, #F8758) and 5-methyltetrahydrofolate (5-MTHF ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% Trifluoroacetic acid (TFA, Merck), 1 M glycolic acid (Sigma) ...
-
bioRxiv - Molecular Biology 2023Quote: Approximately 1 × 107 cells were lysed in 200 μL lysis buffer [50mM Tris pH 8 (Merck, T6066), 150mM NaCl (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Biophysics 2019Quote: ... for 2 h and buffer exchange with centrifugal filter devices (10,000 MWCO, Amicon, Merck Millipore) into storage buffer ...
-
bioRxiv - Molecular Biology 2021Quote: WT MtbRho and the M495L mutant were overexpressed in Rosetta 2(DE3) cells (Merck-Millipore) harboring the appropriate pET28b derivative and purified following published protocols35 with minor modifications ...
-
bioRxiv - Developmental Biology 2019Quote: ... The next day FGF ligands (to 5 nM) and heparin (to 2 μg/ml; Merck) were added ...
-
bioRxiv - Biochemistry 2020Quote: ... and a SeQuant ZIC-HILIC precolumn (5 μm particles, 20 × 2 mm) (Merck, Darmstadt, Germany) using a linear gradient of mobile phase A (5 mM NH4OAc in acetonitrile/H2O (5/95 ...
-
bioRxiv - Biochemistry 2021Quote: Ethanol (absolute for analysis) and 2-propanol (for analysis) were obtained from Merck (Darmstadt, Germany). Sodium chloride (≥99.8%) ...
-
bioRxiv - Cell Biology 2021Quote: 6 μL of 70 kDa FITC-dextran in EGM-2 (5 mg/mL, Merck, #46945) was added to each vessel ...
-
bioRxiv - Cell Biology 2021Quote: ... Intracellularly applied drug: the membrane impermeable G-protein blocker GDP-β-S (2 mM, Merck) (Farkas et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... at a final concentration of 10 ng/ml and phosphatase inhibitor cocktail-2 (P5726, Merck) at 1% (v/v) ...
-
bioRxiv - Immunology 2022Quote: ... EB retained in the brain tissue was extracted by immersion in 2 ml formamide (Merck) at 37°C in the dark for 48 h ...
-
bioRxiv - Biochemistry 2022Quote: ... and the cells grown in 2 L of Overnight Express Instant LB medium (Merck, Germany) containing 100 μg/ml ampicillin at 28 °C for approximately 32 h ...
-
bioRxiv - Microbiology 2022Quote: ... diluted in RPMI 1640 medium supplemented 2 g/L of NaHCO3 (Merck®, Burlington, MA) and 10% fetal bovine serum (Gibco® ...
-
bioRxiv - Biophysics 2022Quote: ... bis-acrylamide (2% w/w) and ammonium persulfate (0.05% w/v) (all from Merck, Germany) in 10 mM Tris-buffer (pH 7.48) ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 μL of extract containing total lipids were separated on TLC (Silica Gel 60, Merck) by using petroleum ether:diethyl ether (90:10 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos from in vitro culture were fixed in a solution containing 2% paraformaldehyde (PFA, Merck) for 20 min at 37° C [41] and ex vivo flushed embryos were fixed in 4% PFA over night at 4° C ...
-
bioRxiv - Immunology 2022Quote: Nose and throat swabs were collected in 2 ml transport medium containing 15% sucrose (Merck), 2.5 µg/ml Amphotericin B ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of terminated reaction mix were spotted onto polyethyl-enimine-cellulose plates (Merck, Germany). ATP and released phosphate were then separated chromatographically in a buffer of 0.5 M LiCl ...
-
bioRxiv - Microbiology 2023Quote: ... 300 μL of aqueous phase was added to 500 μL of 2-propanol (Merck, Germany) and kept overnight at −20°C for RNA precipitation ...
-
bioRxiv - Microbiology 2022Quote: ... After testing for SARS-CoV-2 by PCR test (COBAS 6800, Merck México, Mexico city), they were classified as positive (AP ...
-
bioRxiv - Microbiology 2022Quote: ... Maize was cultured in ¼ Hoagland’s medium (Hoagland’s No. 2 Basal Salt Mixture, Sigma-Aldrich/Merck), pH adjusted to 5.6-5.8 with KOH ...
-
bioRxiv - Immunology 2022Quote: ... Peritoneal cavity cells were obtained by lavage with 5 mL PBS + 2 mM EDTA (Merck). Following gentle massage ...
-
bioRxiv - Neuroscience 2022Quote: ... Two hundred microliters of medium containing 2 μM human insulin (Merck, Sigma-Aldrich Cat# I9278) or medium only was added to the thoraxes for 10 min (the final concentration of insulin was 1 μM) ...
-
bioRxiv - Microbiology 2023Quote: All compounds (zaprinast, heparin, artemisinin, chloroquine, brefeldin A and Torin 2) were sourced from Merck KGaA ...
-
bioRxiv - Microbiology 2023Quote: ... 300 µL of aqueous phase was added to 500 µL of 2-propanol (Merck, Germany) and kept overnight at −20°C ...
-
bioRxiv - Cell Biology 2023Quote: After saponification with 2 mL 1M 95% ethanolic sodium hydroxide solution (Merck KGaA, Darmstadt, Germany) at 60°C for one hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... femurs and tibias in FACS buffer (PBS supplemented with 2% fetal calf serum (FCS; Merck) and 2 mM EDTA (Merck) ...
-
bioRxiv - Genetics 2023Quote: ... was added to each along with a single sterile 2 mm glass bead (Merck, Germany) to each tube ...
-
bioRxiv - Biophysics 2023Quote: ... RNA from yeast diluted in PBS (0.7 and 2 mg/mL; Sigma-Aldrich, Merck #10109223001).
-
bioRxiv - Bioengineering 2023Quote: ... followed by incubation in 10 mL of 2 U/mL dispase solution (D4693; Merck KGaA) at 4 °C overnight ...