Labshake search
Citations for Merck :
751 - 800 of 1657 citations for Potassium 3 4 difluorophenyl trifluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Protein mixtures were incubated with 40μl PBST washed Streptavidin agarose resin (50% slurry, 69203-3 Merck) and incubated for 2h at room temperature on a roller ...
-
bioRxiv - Bioengineering 2024Quote: ... We then dissolved 100 μmol of N-ethyl-N’-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Merck, E7750) in 1 mL of MES buffer and added it to the beaker ...
-
bioRxiv - Neuroscience 2024Quote: ... a group of approximately 50 flies in a training tube alternately received 3-octanol (3OCT; Merck) and 4-methylcyclohexanol (4MCH ...
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein mixture was concentrated using Amicon Ultra 3 kDa MW cut-off device (Merck Millipore) to ∼15 mg/ml and used to set up commercial crystallisation screens using the sitting drop vapour diffusion method at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by incubation with 200 µl of blocking solution [3% bovine serum albumin (BSA) (10735086001; Merck) in PBS-T at 37 °C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Size fractionation of the secretomes was done using ultrafiltration cartridges (Amicon Ultra-4, Merck Millipore Ltd ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were picked up with slot grids and contrasted with 4% aqueous uranylacetate (Merck) and Leynolds lead citrate (Delta microscopies) ...
-
bioRxiv - Biochemistry 2021Quote: ... N-containing fractions were concentrated on the Amicon Ultra-4 Centrifugal Filter Unit (Merck/Millipore ...
-
bioRxiv - Biochemistry 2021Quote: ... N-containing fractions were concentrated on the Amicon Ultra-4 Centrifugal Filter Unit (Merck/Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (#D9542, Merck. Darmstadt. Germany).
-
bioRxiv - Cell Biology 2021Quote: ... proteins were concentrated using Amicon Ultra-4 30 kDa centrifugal filter tubes (#UFC803024, Merck) and resuspended in sterile HBSS containing 1.2 mmol/l Ca2+ ...
-
bioRxiv - Microbiology 2021Quote: ... were diluted 1:500 in 4% bovine serum albumin (BSA) (Sigma-Aldrich, Merck, UK).
-
bioRxiv - Immunology 2021Quote: ... cells were kept at 4°C in PBS containing 0.2 % BSA (Merck, Cat. #A2058) and 5 mM EDTA (Roth ...
-
bioRxiv - Genomics 2021Quote: ... the supernatant was transferred into an Amicon® Ultra-4 centrifugal filter device (Merck Millipore Ltd ...
-
bioRxiv - Cell Biology 2021Quote: ... a small spoonful of lysozyme and 1x BugBuster (Merck Millipore, cat. no. 70584-4) were added ...
-
bioRxiv - Physiology 2022Quote: ... cultures were fixed with 4% PFA and stained with 2% Alizarin red S (Merck). For the quantification ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were then treated for 14 days with 400nM 4-hydroxy tamoxifen (Merck Millipore) and genotyped to confirm complete recombination ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were treated for 14 days with 400nM 4-hydroxy tamoxifen (Merck Millipore) then genotyped to confirm complete recombination ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were treated for four days with 400nM 4-hydroxy tamoxifen (Merck Millipore) then genotyped to confirm complete recombination ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed three times with PBS and mounted in Moviol 4-88 (Merck). Wide-field fluorescence microscope Leica (Leica ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were washed in ice-cold PBS once and fixed in 4 % PFA (Merck) for 20 minutes on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... the medium was aspirated and immediately replaced by pre- warmed 4 % paraformaldehyde (Merck, #P6148) in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... and blocked in blocking solution (4 % (w/v) skim milk powder (Merck, #70166-500G) and 1 % (w/v ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was labeled with 4 ug/ml Hoechst 33342 stain (Merck KGaA Cat# B2261).
-
bioRxiv - Physiology 2022Quote: Masu and cherry salmon hearts were fixed in 4% paraformaldehyde (PFA; Sigma-Aldrich, Merck) at 4°C for 48 h and embedded in paraffin blocks ...
-
bioRxiv - Neuroscience 2022Quote: ... intestines were washed in PBS and fixed overnight in a 4% formaldehyde solution (Merck). Then ...
-
bioRxiv - Zoology 2022Quote: ... the CMC medium was removed and the cells were fixed with 4 % paraformaldehyde (Merck), permeabilized with 0.5 % Triton X-100 (Sigma) ...
-
bioRxiv - Plant Biology 2022Quote: ... and 200 mM Imidazole) and concentrated by Amicon Ultra-4 Centrifugal Filter Unit (Merck). The GST-tagged protein cells were lysed by the sonication in the equilibration buffer-phosphate-buffered saline (10 mM phosphate buffer pH 7.4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and concentrated using an Amicon Ultra-4 (30 k) centrifugal filter (UFC803008, Merck Millipore).
-
bioRxiv - Molecular Biology 2023Quote: ... cells were fixed for 10 minutes at RT with 4% formaldehyde (Merck, Sigma Aldrich) diluted in PBS 1X (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... After mixing with loading buffer (4 x) containing β-mercaptoethanol (80570, Merck, Darmstadt, Germany) and heated to 70 °C for 10 min ...
-
bioRxiv - Biochemistry 2024Quote: ... pooled accordingly and concentrated using Amicon®Ultra-4 centrifugal filter unit (Merck Millipore) to a final volume of 1 ml ...
-
bioRxiv - Cell Biology 2024Quote: ... hAC were fixed with 4% formalin followed by incubation with 0.1 M HCL (Merck) for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: Intraperitoneal injections of 200 mg/kg 4-PBA (820986, MERCK or P21005, Sigma‒Aldrich) were performed daily from 8-9 to 10-11 weeks of age for immunohistochemistry and seizure behavioral assays ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells on the coverslips were fixed with 4% paraformaldehyde (Merck Millipore, Amsterdam, the Netherlands). Cells were permeabilized with 0.1% Triton-X100 (Sigma Aldrich) ...
-
bioRxiv - Biophysics 2023Quote: ... and concentrated in an Amicon Ultra-4 Ultracell 30kDa centrifugal filter (Merck-Millipore #UFC803024). Aliquots were snap frozen and stored at −80 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 L of seawater was filtered through 0.22 µm Sterivex filters (MERCK, MA, USA) and filters were stored at -80°C (33) ...
-
bioRxiv - Developmental Biology 2023Quote: ... NuPage 4 to 12% bis-tris protein gels (NP0323, Thermo Scientific; or MP42G15; Merck) before transferring into 0.22μm pore size polyvinylidene difluoride (PVDF ...
-
bioRxiv - Immunology 2023Quote: ... cells were fixed for 30 min at 4 °C with 0.4% paraformaldehyde (Merck KGaA) and permeabilized with PBS containing 2% FBS and 0.1% saponin (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... The sections were fixed with 4% paraformaldehyde and stained with hematoxylin (Merck, no. 105174), 0.1 % hydrochloric acid ...
-
bioRxiv - Genomics 2023Quote: ... for 10 min at 4°C and then with fixable viability dye DAPI (Merck), Vybrant Ruby (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... cells were fixed by incubation with PBS containing 4% (w/v) paraformaldehyde (Merck, #104005100) for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed with PBS and fixed with 4% PFA (Merck, 50-00-0) for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... and concentrated by centrifugation through an Amicon Ultra-4 Centrifugal Filter Device (Merck Millipore). Native dynactin was purified from fresh pig brains as previously described (Schlager et al ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by the same volume of ice-cold 4% paraformaldehyde (PFA) (1.04005.1000, Merck Millipore) in 0.1 M phosphate buffer (PB ...
-
bioRxiv - Developmental Biology 2024Quote: ... grids were post-stained with 2% aqueous uranyl acetate at pH 4 (Merck, Germany) and Reynold’s lead citrate ...
-
bioRxiv - Genetics 2024Quote: ... Proteins were separated by SDS-PAGE using 4-12% Bis-Tris gels (Merck, #MP41G12) and transferred onto an activated PVDF membrane (Merck ...
-
bioRxiv - Immunology 2024Quote: Sections were counterstained for Epcam by overnight incubation at 4°C with HPA026761 (Merck) rabbit primary antibody ...
-
bioRxiv - Molecular Biology 2024Quote: ... coated with 4 uL of Engelbreth-Holm-Swarm murine sarcoma ECM gel (E1270, Merck). Muscle fibers were kept in α-MEM containing 5% fetal bovine serum in a cell incubator (37°C ...