Labshake search
Citations for Merck :
751 - 800 of 4496 citations for 6 Bromo 3 phenyl imidazo 1 2 a pyridine 2 carboxylic acid methyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Cell Biology 2022Quote: Snap-Streptavidin-WA-His (pETplasmid) was expressed in Rosettas 2 (DE3) pLysS (Merck, 71403). Culture was grown in TB medium supplemented with 30 μg/mL kanamycine and 34 μg/mL chloramphenicol ...
-
bioRxiv - Cell Biology 2022Quote: ... Mission siRNA for human Pacsin 2 siRNA (SASI_Hs01_0021-5538, SASI_Hs01_0021-5539 and SASI_Hs01_0021-5540, Merck) or MISSION siRNA Universal Negative Control #1 (SIC-001 ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were further concentrated to 2-10 mg/ml using Amicon concentration devices (Merck, 3,000 Da ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5% NaCl (Mercury Cat#1064041) and 0.5% yeast extract (Merck Cas#8013-01-2)) supplemented with 250 mg/ml glucose (Mercury Cas#50-99-7) ...
-
bioRxiv - Neuroscience 2022Quote: Drugs were used at the following concentrations: 2 µM PMA (Merck Millipore Cat#524400), 1 µM Bradykinin (Sigma-Aldrich Cat#05-23-0500) ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by 2 layers of SCX strong cation exchange Empore™ SPE Disks (Merck). Samples were then lyophilized.
-
bioRxiv - Biochemistry 2023Quote: ... 100mM NaCl using 3k cut-off Amicon® Ultra 2 mL Centrifugal Filters (Merck). Equal amounts of protein from both dialyzed and undialyzed samples were treated with caspase-3 as described above ...
-
bioRxiv - Plant Biology 2023Quote: ... then 2% w/v Aspegillus niger pectinase (Merck Life Science UK Ltd., Gillingham, UK) 45°C for 2 hours ...
-
bioRxiv - Biophysics 2023Quote: Snap-Streptavidin-WA-His (pETplasmid) was expressed in Rosetta 2 (DE3) pLysS (Merck, 71403). Culture was grown in TB medium supplemented with 30 µg/ml kanamycin and 34 µg/ml chloramphenicol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The eluted samples were concentrated using an Amicon Ultra-2 centrifuge filter unit (Merck) and stored on ice.
-
bioRxiv - Molecular Biology 2023Quote: ... CaCo-2 cell lines were cultivated in Minimum Essential Medium Eagle (MEM) (Merck, M4655) complemented with 20% FBS Tetracycline free ...
-
bioRxiv - Developmental Biology 2023Quote: ... except for a different set of SYBR green primers (Sigma Merck, Supplementary Table 2). The obtained Ct values were analyzed using the ddCt method for relative quantification of mRNA expression derived from three independent experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... concentrated using 100 kDa-MWCO Centricon plus-20 and Centricon plus-2 (Merck-Millipore), aliquoted and stored at -80°C ...
-
bioRxiv - Cell Biology 2023Quote: ... and concentrated to 65 µL using Amicon Ultra-2 10K filters (Merck Life Science).
-
bioRxiv - Biophysics 2022Quote: Snap-Streptavidin-WA-His (pETplasmid) was expressed in Rosettas 2 (DE3) pLysS (Merck, 71403). Culture was grown in TB medium supplemented with 30 μg/mL kanamycine and 34 μg/mL chloramphenicol ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 M urea (Merck), 1% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Biochemistry 2023Quote: ... 40 μg of protein was added to each well and run in Boric acid-Tris buffer (192 mM Boric acid, Merck; 1 mM EDTA, Merck; 0.1% SDS, to pH 7.6 with Tris) at 25 mA for 1.5 h ...
-
bioRxiv - Microbiology 2020Quote: ... and finally through a 0.22 μm collection filter (Cellulose mixed ester membrane filter; Merck Millipore, USA). The pre-processed samples were then kept in 2 ml microcentrifuge tubes ...
-
bioRxiv - Microbiology 2022Quote: ... followed by filtration through a MF-Millipore 8 µm sterile mixed cellulose ester (MCE) membrane (Merck Millipore Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: ... and counterstained with Fast Green (0.04% w/v in 1% acetic acid, Merck, Darmstadt, Germany).
-
bioRxiv - Genetics 2022Quote: ... or SD complete amino acid agar (0.67% yeast nitrogen base with amino acids (Merck), 2% glucose ...
-
bioRxiv - Molecular Biology 2023Quote: ... To deplete Xrn1 and Dcp2 with the AID tags (Nishimura et al., 2009; Morawska and Ulrich, 2013) 1-Naphthaleneacetic acid (1-NAA; N0640-25G, Merck) was added to a final concentration of 1 mM ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and formic acid from Merck were used for HPLC separations ...
-
bioRxiv - Physiology 2022Quote: ... Phosphomolybdic Acid Orange G (Merck AG ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.01% pluronic acid (Merck) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 14% acetic acid (Merck). Plates were washed in water ...
-
bioRxiv - Physiology 2019Quote: ... ethylenediaminetetraacetic acid (EDTA) from Merck.
-
bioRxiv - Biochemistry 2019Quote: ... and glacial acetic acid (Merck) (v/v 85:15 ...
-
bioRxiv - Microbiology 2020Quote: ... propionic acid (Merck, Darmstadt, Germany), n-valeric acid (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Pure oxalic acid (Merck, Germany) was identified by the retention time and was quantified by an external standard curve ...
-
bioRxiv - Microbiology 2022Quote: ... L-lactic acid (~90%, Merck), ethanol and glycerol were added to final concentrations of 40 mM ...
-
bioRxiv - Physiology 2022Quote: ... water and formic acid (Merck) in different proportions ...
-
bioRxiv - Cell Biology 2023Quote: ... and L-ascorbic acid (Merck) supplemented with FGF2 (4 ug/mL ...
-
bioRxiv - Immunology 2023Quote: ... and concentrated sulfuric acid (Merck) for at least 30 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Linolenic acid (L2376-500MG, Merck), L-Carnitine hydrochloride (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 150 µM ascorbic acid (Merck), 55 µM β-mercaptoethanol (Thermo Fisher) ...
-
bioRxiv - Genetics 2023Quote: ... folic acid (FA, Merck, #F8758) and 5-methyltetrahydrofolate (5-MTHF ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% Trifluoroacetic acid (TFA, Merck), 1 M glycolic acid (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Biophysics 2019Quote: ... for 2 h and buffer exchange with centrifugal filter devices (10,000 MWCO, Amicon, Merck Millipore) into storage buffer ...
-
bioRxiv - Molecular Biology 2021Quote: WT MtbRho and the M495L mutant were overexpressed in Rosetta 2(DE3) cells (Merck-Millipore) harboring the appropriate pET28b derivative and purified following published protocols35 with minor modifications ...
-
bioRxiv - Developmental Biology 2019Quote: ... The next day FGF ligands (to 5 nM) and heparin (to 2 μg/ml; Merck) were added ...
-
bioRxiv - Biochemistry 2020Quote: ... and a SeQuant ZIC-HILIC precolumn (5 μm particles, 20 × 2 mm) (Merck, Darmstadt, Germany) using a linear gradient of mobile phase A (5 mM NH4OAc in acetonitrile/H2O (5/95 ...
-
bioRxiv - Biochemistry 2021Quote: Ethanol (absolute for analysis) and 2-propanol (for analysis) were obtained from Merck (Darmstadt, Germany). Sodium chloride (≥99.8%) ...
-
bioRxiv - Cell Biology 2021Quote: ... Intracellularly applied drug: the membrane impermeable G-protein blocker GDP-β-S (2 mM, Merck) (Farkas et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... at a final concentration of 10 ng/ml and phosphatase inhibitor cocktail-2 (P5726, Merck) at 1% (v/v) ...