Labshake search
Citations for Merck :
751 - 800 of 819 citations for 192 IgG Mouse Monoclonal Cy3 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... brain sections were subjected to immunohistochemistry using a mouse anti-NeuN antibody (MAB377; Merck, Kenilworth, NJ, USA; 1:500) followed by incubation with an anti-mouse IgG antibody (Vector Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Immuno-reactive complexes were detected using horseradish-peroxidase coupled anti-rabbit or anti-mouse antibodies (Sigma-Aldrich/Merck, Germany) and subsequent detection of chemiluminescence signals with a ChemoCam Camera system (INTAS Science instruments GmbH ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies diluted in 5% milk/PBS-Tween were: mouse anti-Actin (1:2000; Merck, Germany, Cat. No. MAB1501), rat anti-MYC (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... Hybridization signals were detected using anti-mouse secondary antibodies conjugated with alkaline phosphatase using BCIP/NBT substrates (Merck Inc.).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and incubated overnight in the same solution with the primary antibody to CB1R (1:1,000, rabbit, Immunogenes) and neuronal nuclei (NeuN) (1:1,000, mouse, MAB377, Merck Millipore), at 4 °C ...
-
bioRxiv - Genetics 2022Quote: ... followed by overnight incubation at 4°C with primary antibodies (Anti-ASL, Abcam ab97370, 1:1000; Anti-GAPDH mouse, Abcam ab8245, 1:10,000; Anti-nitrotyrosine, Merck 05-233 ...
-
bioRxiv - Neuroscience 2023Quote: ... The HRP-Conjugated secondary antibodies((Anti-Rabbit (raised in goat) and anti-Mouse (raised in goat)) were from Merck. ...
-
bioRxiv - Plant Biology 2023Quote: ... diluted 1:1000 in 1xTBST buffer (50 mM Tris, 150 mM NaCl, 0.1% Tween 20) and the anti-mouse secondary antibody (Merck) diluted 1:10000 in 1xTBST ...
-
bioRxiv - Microbiology 2023Quote: ... insulin and proglucagon were measured using the Luminex™ Mouse Metabolic Hormone Expanded kit (Merck & Co., Inc. Kenilworth, NJ). Also ...
-
bioRxiv - Molecular Biology 2023Quote: ... PLA was performed using Duolink In Situ Red Starter kit (Mouse/Rabbit) according to the manufacturer protocol (Merck, DUO92101).
-
bioRxiv - Microbiology 2024Quote: ... Whole cell samples were then analysed by immunoblot using anti-puromycin antibody (1:2000, anti-mouse, clone 12D10, Merck). As a loading control a duplicate SDS-PAGE was performed ...
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed once and then incubated with the appropriate fluorescently labelled secondary antibody (anti-mouse polyvalent Ig-FITC (Merck) or anti-His6 HIS.H8 DyLight 488 ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at room temperature in darkness with the primary antibody solution containing mouse anti-vesicular Glutamate Transporter 1 (vGLUT1, 1:1000, MAB5502, Merck) or rabbit anti-Glutamate Decarboxylase 65-67 (GAD 65-67 ...
-
bioRxiv - Neuroscience 2020Quote: ... The blots were blocked in PBS/ 0,05%Tween20 containing 5% skim milk and then probed with the following primary antibodies over night at 4°C: mouse anti-P53 (1:100, Merck), rabbit anti-H2AX (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... blocked with 10% bovine serum albumin (BSA) 30 min at 37°C and incubated with primary anti-γH2A.X mouse antibodies (Merck Millipore) or rabbit anti-LC3B antibodies (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse LL/2 (LLC1; ATCC no. CRL-1642; obtained in 2015) was grown in BME with Earle′s salts (Merck) with the same supplementation as mentioned above ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at room temperature in darkness with the primary antibody solution containing mouse anti-vesicular Glutamate Transporter 1 (vGlut1, 1:1000, MAB5502, Merck) and rabbit anti-Glutamate Decarboxylase 65-67 (GAD 65-67 ...
-
bioRxiv - Neuroscience 2019Quote: ... AB5543), chicken anti-β3 tubulin (1:500, AB9354) and mouse anti-ankyrin G (1:500, MABN466) were purchased from Merck Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000, Merck Millipore ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following antibodies were used for ChIP analysis: Mouse anti-RNA polymerase II antibody clone CTD4H8 (Merck Millipore, 05-623), Rabbit anti-NF-kB p65 antibody clone D14E12 (Cell Signalling ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were run on SDS-PAGE and the expression of IDO1 was analyzed with a mouse anti-IDO1 antibody (clone 8G-11, Merck). Mouse monoclonal Ab against β-tubulin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: Proximity ligation assays with Aurora A kinase and MP-GAP were performed in HeLa cells using mouse anti-Aurora A Kinase antibody (1:500, A1231 Merck), rabbit anti-MP-GAP antibody (1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation with a rabbit anti-Kv4.3 primary antibody (1:10000, Alomone Labs) together with chicken (G)/mouse (L) anti-TH primary antibody (1:1000, Abcam / Merck) in a carrier solution (1% NGS ...
-
bioRxiv - Cancer Biology 2023Quote: ... one mouse was exposed by drinking water to a mixture of BPA (1 µM, CAS no. 80-09-1, Merck) and DEHP (1 µM ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were incubated with secondary antibodies conjugated with PLA probes MINUS and PLUS: the PLA probe anti-mouse PLUS and anti-rabbit MINUS (Merck). Incubation with all antibodies was accomplished in a humidified chamber for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked in 5% skim milk in TBS for 1 hour and probed with mouse γ/9d 2G10.2 (1:1000, MERCK MABT1335), rabbit anti mouse IgG (1:3000 ...
-
bioRxiv - Immunology 2021Quote: ... Mouse peritoneal macrophages (MPMs) were isolated from mice 4 d after the intraperitoneal injection of thioglycollate (Merck & Co.; Kenilworth, NJ, USA) as described previously(Zhang et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were collected in PBS in 24-well plates and processed for free-floating immunofluorescence using primary polyclonal antibodies that label neurons (NeuN, mouse; 1: 1000, Millipore MAB377, Merck Millipore), reactive astrocytes (GFAP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the slides were incubated for 1 h at room temperature with the appropriate biotin-conjugated secondary antibody: goat anti-mouse (21538, Merck-Millipore) for CD3 and goat anti-rat (BP-9400 ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies were detected with horseradish peroxidase conjugated anti-rabbit and anti-mouse antibodies and visualized by enhanced chemiluminescence detection (Luminata Forte Western HRP substrate, Merck Millipore). Digital images were acquired on a ChemiDoc XRS System (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were centrifuged for 5 min at 20 000 x g and supernatants were immunoprecipitated for 1 h rotating at 4°C with mouse anti-GFP antibody (1 µg antibody per sample, 11814460001 Merck/Sigma) and 20 µl DynabeadsTM Protein G (10004D ...
-
bioRxiv - Biophysics 2022Quote: ... followed by incubation in LI-COR blocking buffer containing rabbit polyclonal anti-P2X2 (#APR-003, Alomone labs; 1:2000) and mouse anti-Na+/K+-ATPase (05-369; EMD Merck Millipore) at 4 °C overnight ...
-
bioRxiv - Neuroscience 2021Quote: Immunohistochemical staining was performed on free-floating brain sections using the following primary antibodies: mouse anti-rat TH (1:4000, MAB318, Merck Millipore), rabbit anti-Girk2 (1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... Blots were incubated with goat anti-mouse horse radish peroxidase (HRP)-conjugated secondary antibody and the bands developed with Luminata Forte Western HRP Substrate (Merck Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... The supernatants were then used to quantify the level of adiponectin using Mouse Adiponectin ELISA kit (Merck Millipore #EZMADP-6 K) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... brain sections were blocked with 5% normal donkey serum for 1 h at room temperature and incubated with primary antibodies (rabbit anti-GFAP 1:200, Dako; goat anti-Iba1, 1:500 Wako; NeuroTrace™ 1:200, Thermo Fischer; mouse anti-NeuN Antibody 1:500, Merck, #MAB377 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... slices were incubated for 24-48h at 4°C with mouse anti-Neurophysin I (1:2000, Merck Millipore, marker for Oxytocin), rabbit anti-vasopressin (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... and mouse BRCA2 (amino acid residues: 2232-2283) were cloned into pMAT11 (Peranen et al., 1996) and pRSF-Duet1 (Merck Millipore) vectors for expression with an N-terminal TEV-cleavable His6-MBP tag and an N-terminal TEV-cleavable MBP tag ...
-
Autoimmune inflammation triggers aberrant astrocytic calcium signaling to impair synaptic plasticitybioRxiv - Neuroscience 2023Quote: ... The purity of the cultures was be routinely assessed by examining the characteristic cell morphologies under phase-contrast microscopy and confirmed by immunostaining with mouse anti-GFAP (1:200; Merck, MAB3402) and mouse anti-S100β (1:400 ...
-
bioRxiv - Neuroscience 2023Quote: ... R&D, AF2408), Goat-Anti Human SOX17 (1:100, R&D, AF1924) or Mouse Anti-Human Beta-Tubulin (1:1000, Merck, T8660) primary Chicken Anti-Human MAP2 (1:2000 ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated in a 10% (v/v) HS PBS solution supplemented with primary mouse anti-β-tubulin III antibody (1:100; Merck) overnight at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were permeabilized with 100% ice-cold methanol for 20 min at -20°C and rehydrated by washing with PBS and then stained for viral hexon protein expression with an anti-hexon primary antibody (mouse; Merck; #MAB8052) and an anti-mouse secondary antibody coupled to AF488 or AF647 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... TNF-alpha and IL-10 in serum were determined using bead-based Multi-Plex kits (MILLIPLEX® Mouse Cytokine/Chemokine Magnetic Bead Panel 96-Well Plate Assay, Merck KGaA ...
-
bioRxiv - Neuroscience 2024Quote: ... IL-10 and TNF-α were quantified in the FN of NL and at 21dpi aged GFAP-IL6Tg and WT mice (n= 4-6/experimental group) using a Milliplex MAP Mouse High Sensitivity kit (#MHSTCMAG-70K; Merck Millipore), following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... in maternal serum and placenta was performed with MILLIPLEX MAP Mouse Cytokine/Chemokine Magnetic Bead Panel – Immunology Multiplex Assays (MCYTOMAG-70K, Merck Millipore, Germany) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: Quantification of Th1/Th2 cytokines in supernatant of splenocytes was performed using mouse high sensitivity T cell magnetic bead panel assay (MHSTCMAG-70K, Merck, Darmstadt, Germany). 5×105 isolated splenocytes were co-cultured with different stimuli in 200 μL RPMI + 10% FBS ...