Labshake search
Citations for Merck :
701 - 750 of 1897 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM DTT) using Amicon Ultra-15 3 K or 30 K centrifugation units (Merck Millipore). The phase separation assay was performed in the presence or absence of 10% polyethylene glycol 8000 (PEG-8000 ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat # UFC500396) and centrifuged for 45 min at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: Wild-type (WT/AB) embryos at 3 dpf were anaesthetised in 0.2 mg/ml MS222 (Merck) and mounted on 1.2 % w/v/ low-melting point agarose (Merck) ...
-
Decoupling cell size homeostasis in diatoms from the geometrical constraints of the silica cell-wallbioRxiv - Microbiology 2023Quote: ... After 3 washes with deionized water (Milli-Q® IQ 7003 Ultrapure Lab Water System, Merck), the cells were dehydrated by washing in a graded series of ethanol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Immunology 2023Quote: ... Excess of chelator was removed by ultrafiltration (Amicon Ultra 0.5 ml, 3 kDa MWCO, Merck Millipore) using the same buffer conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were blocked with 3% freshly made bovine serum albumin (BSA)/PBS buffer (Sigma-Aldrich/Merck). The antibody mix containing the individually diluted metal-conjugated antibodies in 0.5% BSA/PBS was applied to the slides ...
-
bioRxiv - Microbiology 2023Quote: ... We used sterile-filtered 3 % bovine serum albumin (BSA heat shock fraction, pH 7, > 98 %, Merck) in 1 × Pierce PBS buffer (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2023Quote: ... and the flow-through was concentrated using an Amicon Ultracentrifugal filter (3 kDa MWCO, Merck-Millipore) and further purified by gel filtration (HiLoad™ 16/600 Superdex™ 200 gp ...
-
bioRxiv - Immunology 2023Quote: ... Pepstatin A Methyl Ester (Pepstatin A, 516485) and MCC950 (256373-96-3) were purchased from Merck. Ultrapure™ DNase/RNase-Free Distilled Water (10977035 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng G-CASE and 3 mL PEI solution (1 mg/mL) (Merck KGaA, Darmstadt, Germany). 100 µL transfected cells were seeded per well onto 96-well plates (Brand ...
-
bioRxiv - Bioengineering 2024Quote: ... and the elution fractions were concentrated with Amicon Ultra centrifugal filter units (3 kDa, UFC800324, Merck) to a concentration of 0.24 mg/mL (3.6 µM) ...
-
bioRxiv - Bioengineering 2024Quote: ... We then dissolved 100 μmol of N-ethyl-N’-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Merck, E7750) in 1 mL of MES buffer and added it to the beaker ...
-
bioRxiv - Neuroscience 2024Quote: ... a group of approximately 50 flies in a training tube alternately received 3-octanol (3OCT; Merck) and 4-methylcyclohexanol (4MCH ...
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by incubation with 200 µl of blocking solution [3% bovine serum albumin (BSA) (10735086001; Merck) in PBS-T at 37 °C for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant fraction was collected and incubated with S-protein beads (Merck) for 2 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were concentrated by ultrafiltration using Amicon Ultra centrifugal filters (Merck Millipore) with 50 kDa cut off ...
-
bioRxiv - Developmental Biology 2020Quote: ... Protein was concentrated using an Amicon 10 kD filter column (Merck UFC801008D) and purity tested by SDS-PAGE.
-
bioRxiv - Molecular Biology 2021Quote: ... proteins were transferred from the gel to a PVDF membrane (Merck, IPFL00010) by semi-dry transfer with Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-Ubiquitinylated proteins,clone FK2 (cat# 04-263, Merck Millipore; 1:1000). Ponceau solution was prepared with Ponceau BS (cat# B6008 ...
-
bioRxiv - Biophysics 2020Quote: ... polyclonal antibody against brain lipid binding protein (BLBP) (Millipore, Merck KGaA, Germany), mouse antibody against nestin (Millipore ...
-
bioRxiv - Physiology 2020Quote: ... proteins were transferred to a PVDF membrane (Immobilon-P, Merck Millipore, IPVH00010) with 160 mA for 90 min ...
-
bioRxiv - Neuroscience 2020Quote: ... the protein solution was filtered through a 100 kDa filter (MERCK, MRCFOR100). The filtrate was transferred to a low-protein binding tube and 20 equivalents of dopamine (final concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... All remaining protein constructs were cloned into the pET28b vector (Merck Millipore). Unless otherwise stated ...
-
bioRxiv - Biophysics 2021Quote: ... Separated proteins were transferred onto a PVDF membrane (IPVH00010, Immobilon-P; Merck) and incubated for 2hr with blocking buffer containing 5% Skimmed milk (70166 ...
-
bioRxiv - Plant Biology 2020Quote: ... Protein concentrations were measured using a Direct Detect® Infrared Spectrometer (Merck).
-
bioRxiv - Microbiology 2020Quote: Infected insect cells were disrupted with CytoBuster™ protein extraction reagent (Merck) and clarified by centrifugation at 4,300 × g for 20m before column loading ...
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were visualized with Immobilon Western Chemiluminescent HRP Substrate (Merck Millipore).
-
bioRxiv - Microbiology 2020Quote: ... GST bound protein was then cleaved using biotinylated thrombin (Merck Millipore; 69672) according to the manufacturers instructions overnight at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were transferred onto the methanol-activated µm PVDF membrane (Merck #ISEQ85R) using 1X transfer buffer (2.5 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: The Magna RNA-binding protein immunoprecipitation kit (Merck Millipore, Billerica, MA, USA) was applied for the assay ...
-
bioRxiv - Biophysics 2020Quote: ... 100 μl of 10 μg/ml recombinant protein G (Merck, Darmstadt, Germany) was added and incubated for 30 minutes ...
-
bioRxiv - Biophysics 2020Quote: ... The protein was filtered through a 0.22 μm Millex-GV filter (Merck) to remove potential aggregates ...
-
bioRxiv - Cell Biology 2021Quote: Co-IP was performed using Protein G Immunoprecipitation Kit (Merck, Cat # IP50) as per the manufacturer's protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were concentrated using 30K Amicon Ultra Centrifugal Filters (Merck, Darmstadt, Germany), flash-frozen in liquid nitrogen and stored at −80°C.
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were transferred to Immobilon-P PVDF membrane (Merck Millipore, MA, U.S.A). The membranes were incubated for 1h using 5% low-fat milk solution in 1X TBS (50 mM Tris-Cl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were electrotransferred onto an Immobilon-fl polyvinylidene difluoride (PVDF) membrane (Merck) at 30 V for 1 hour followed by100 V for a further hour at 4°C in 1× NuPAGE Transfer Buffer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Following transfer of the proteins onto a PVDF membrane (Merck Milipore, ISEQ00010), the blots were saturated with 5% BSA in Tris-buffered saline (TBS ...
-
bioRxiv - Immunology 2022Quote: ... Proteins were transferred to Immobilon-FL polyvinylidene difluoride (PVDF) membranes (Merck Millipore), which were subsequently blocked with 5% blotting grade blocker (cat# 170-6404 ...
-
bioRxiv - Biochemistry 2022Quote: ... Selenomethionine-labelled proteins were expressed in Escherichia coli B834(DE3) cells (Merck). All other proteins were expressed in Escherichia coli BL21(DE3 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The resolved proteins were electrotransferred to an Immobilon-P membrane (Merck, IPVH00010). The membrane was probed with specific antibodies listed in Supplementary Table 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein lysates were concentrated using Microcon-10kDa Centrifugal Filter Units (Merck Millipore), according to manufacturer’s instructions and protein concentration was determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... The desalted protein was concentrated on an Amicon 10,000 MWCO (Merck, Germany) and filtered through a 0.22 µM membrane.
-
bioRxiv - Molecular Biology 2021Quote: ... after which the proteins were transferred to Immobilon P membranes (Merck Millipore). After blocking the membrane with 5% skimmed milk in TBS-T buffer solution for 1 h at RT or overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... protein was concentrated using a centrifugation filter (3K, Amicon, Merck, Darmstadt, Germany) up to a final concentration of 5 mg/mL and stored at −80°C.
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were transferred to a PVDF membrane (Merck Millipore cat. No. IPFL00010) after which the membrane was blocked using Odyssey Blocking buffer (PBS ...
-
bioRxiv - Biophysics 2021Quote: ... proteins were separated from salts and concentrated using Amicon Ultra 15 (Merck). Full length DnaK chaperone was purified by Ni2+-NTA column ...
-
bioRxiv - Neuroscience 2020Quote: ... Thirty μl of PureProteome™ Protein A/G Mix Magnetic Beads (Merck) was washed in TBST and then incubated with 5 μl anti-HA antibody for 60 min at room temperature ...