Labshake search
Citations for Merck :
701 - 750 of 4461 citations for 6 Amino 3 morpholin 4 ylmethyl indazole 1 carboxylic acid tert butyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... were fixed with 4% formaldehyde (Merck) diluted in PBS 1X for 10 min at room temperature and then washed 3 times with PBS 1X ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... 250 ng of each plasmid encoding VN and VC were transfected using 4 μL of 1 μg/mL PEI (Merck) for each μg of DNA ...
-
bioRxiv - Biophysics 2021Quote: ... fluorescently-labeled and biotinylated H57-scFV were concentrated to 0.2 - 1 mg/mL with 10 kDa Amicon®Ultra-4 centrifugal filters (Merck) and stored in 1x PBS supplemented with 50 % glycerol at -20°C ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were blocked in 5% milk in TBS-T and incubated overnight at 4°C with the primary antibodies anti-tyrosine hydroxylase (1:1,000; AB152; Merck Millipore) or anti-dopa decarboxylase (1:500 ...
-
bioRxiv - Genetics 2020Quote: ... Bone tissue was cut into 2-mm pieces and placed in PBS buffer containing 4% paraformaldehyde (Schuchardt, Muenchen, Germany) and 1% glutaraldehyde (Merck, electron microscopy grade ...
-
bioRxiv - Neuroscience 2021Quote: ... After washing the sections were incubated overnight at 4°C with anti-NeuN antibody (1:1000, Merck Millipore, Cat. # ABN90P) in 1% normal goat serum and 0.1% Triton-X-100 in TBS ...
-
bioRxiv - Neuroscience 2020Quote: ... The blots were blocked in PBS/ 0,05%Tween20 containing 5% skim milk and then probed with the following primary antibodies over night at 4°C: mouse anti-P53 (1:100, Merck), rabbit anti-H2AX (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... then dialysed against the same stock of ITC buffer overnight at 4°C using 1 kDa Pur-a-lyzer tubes (Merck). Protein and RNA concentrations after dialysis were calculated by A280 and A260 absorbance respectively ...
-
bioRxiv - Physiology 2020Quote: ... blocked in 5% NGS and 0.5% Triton diluted in PBS and incubated over night at 4°C with primary antibody: rabbit anti-NG2 (1/50, AB5320, Merck), goat anti-PDGFRα (1/200 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CM was concentrated to 1 ml at 4 °C using a 10 kDa Centricon Plus-70 centrifugal unit (Merck Millipore ...
-
bioRxiv - Plant Biology 2019Quote: ... 2.5 mM desthiobiotin [IBA]) and concentrated to a final volume of about 1 mL using Amicon Ultra-4 30 K filters (Merck). Purity of proteins was analyzed by SDS-PAGE using 10 % Mini-PROTEAN® TGX™ Precast Gels (BioRad ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sections were washed and incubated overnight at 4°C with anti-Digoxigenin-AP antibody (45-11093274910 Merck-SIGMA, 1:1000). Staining was achieved by adding a solution of 4-Nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Microbiology 2023Quote: ... Clarification was then performed by centrifugation for 1 hour at 12,000g and 4°C and vacuum filtration using 45um nylon filter systems (SteriFlip - Merck Millipore). Prior to purification ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C then moved to 37°C and incubated for 1 h with or without 100 µM cytochalasin D (Merck), 100 µM jasplakinolide (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... The pooled fractions were diluted with 2 vols of KPEM buffer to achieve a final concentration of 125 mM KCl and then incubated for 1 hr with 4 mL anti-FLAG monoclonal antibody conjugated resin (M2 agarose, Merck) using rolling ...
-
bioRxiv - Bioengineering 2023Quote: ... Then these samples were incubated in Alexa Fluor 488 conjugated mouse monoclonal anti-CTSK antibody (1:100) at 4°C overnight (Merck) and then for 1h under agitation at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryo and skin sections were then incubated with the primary antibodies overnight at 4°C (LHX2, 1:1000, #3030529 Merck, Darmstadt ...
-
bioRxiv - Molecular Biology 2024Quote: ... were mixed at a ratio of 4:1 based on monomer and injected onto a gel-filtration column (Superdex 200, 16/600, Merck) equilibrated in 20 mM HEPES buffer (pH 8.0) ...
-
bioRxiv - Neuroscience 2024Quote: ... or Tris-HCl buffered saline (TBS) and incubated at 4°C overnight with primary antibodies (anti-Nr4a2, Abcam, ab41917, 1:500 dilution; anti-GluA1, Merck-Millipore ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μl 40 mM glucose-6-phosphate (Sigma-Aldrich, now Merck KGaA) and 20 μl 35 mM NADP+ (KMF OptiChem ...
-
bioRxiv - Bioengineering 2020Quote: ... insulin (n=6; 20 U, Vetsulin, Merck Animal Health, Madison, NJ, USA), 2-deoxy-D-glucose (n=6 ...
-
bioRxiv - Immunology 2021Quote: ... mature macrophages (n=6 individual donors) were detached using Accutase (Merck Millipore), blocked with 10% pooled human serum in PBS for 30 minutes and incubated with various concentrations of rRABV-tG (0-100 μg/mL ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μM 6-benzylaminopurine (BAP; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.2 mL of a 0.2 M acetylacetone (Merck, cat# 123—54-6) solution was added to the former solution and kept in a water bath at 70°C for 10 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... and 0.36 U glucose-6-phosphate dehydrogenase (G6PDH) (G7877; Sigma-Aldrich/Merck) to each tube ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Biochemistry 2020Quote: ... actin was let to polymerize in PBS for 30 min at room temperature before adding 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholiniumchloride (DMTMM, MERCK) cross-linker ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP (1:2000) (Faix et al., 2001) or mouse monoclonal antibody against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:1000; #CB1001-500UG, Merck (Darmstadt, Germany)) and anti-fascin antibody 5E2 (undiluted hybridoma supernatant) ...
-
bioRxiv - Biochemistry 2019Quote: ... The final protein preparations were concentrated to 1 mM using Amicon® Ultra 10 or 3 kDa cut off centrifugal filters (Merck KGaA). Aliquots were frozen in liquid nitrogen and stored in −80 °C.
-
bioRxiv - Neuroscience 2023Quote: ... was dissolved in vehicle (Ringer solution; NaCl 140 mM, CaCl21.2 mM, KCl 3 mM and MgCl2 1 mM (Merck KGaA Darmstadt, Germany)) to a dilution of 5.5μg/μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... the slides were rinsed three times with PBS and blocked for 1 hour at RT in blocking buffer made with 3% BSA (Merck Millipore, 0218072801) and 0.02% Triton X-100 (Sigma ...
-
bioRxiv - Genomics 2020Quote: ... Free nucleic acids were then digested with 60 units/ml Benzonase Nuclease (Merck) for at least 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... we tried to contrast the lysis stimulation by contemporarily adding tranexamic acid (Merck) at a final concentration of 100 μM ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5 g 2-(N-morpholino)ethanesulfonic acid (ULTRON grade, Merck KGaA, Darmstadt, Germany), and 5 g Gelrite (Duchefa) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The spectrum was collected after addition of 2,5-dihydroxybezoic acid matrix substance (Merck) using an UltrafleXtremeTM MALDI-TOF/TOF mass spectrometer (Bruker Daltonics ...