Labshake search
Citations for Merck :
701 - 750 of 1707 citations for 3 2 Methoxy phenoxymethyl piperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and the flow-through was concentrated using an Amicon Ultracentrifugal filter (3 kDa MWCO, Merck-Millipore) and further purified by gel filtration (HiLoad™ 16/600 Superdex™ 200 gp ...
-
bioRxiv - Immunology 2023Quote: ... Pepstatin A Methyl Ester (Pepstatin A, 516485) and MCC950 (256373-96-3) were purchased from Merck. Ultrapure™ DNase/RNase-Free Distilled Water (10977035 ...
-
bioRxiv - Bioengineering 2023Quote: Wild-type (WT/AB) embryos at 3 dpf were anaesthetised in 0.2 mg/ml MS222 (Merck) and mounted on 1.2 % w/v/ low-melting point agarose (Merck) ...
-
bioRxiv - Biochemistry 2022Quote: ... excess cisplatin and thiourea was removed by centrifugal filtration (Merck, Amicon® Ultra 3 kDa filters) at 14,000 rcf for 10 minutes at 4 °C ...
-
bioRxiv - Biophysics 2022Quote: ... Proteins were concentrated using a centrifugal filter unit (3 kDa MWCO, Merck Millipore; Cat. No. UFC900324) at 3500 rpm and 4°C ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... in absolute ethanol (Thermo-Fischer; order code AJA214-2.5LPL) and 3 mL of propionic acid (Merck, Pty Ltd. ...
-
bioRxiv - Plant Biology 2022Quote: ... and the protein was concentrated in a centrifugal concentrator (Amicon MWCO 3 kDa: Merck, Darmstadt, Germany) and stored at −20 °C in dialysis buffer (150 mM NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat # UFC500396) and centrifuged for 45 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 3-10 mL of liquid culture was filtered through 0.2 um Polycarbonate (PC) membrane filters (Merck Millipore Ltd ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were blocked with 3% freshly made bovine serum albumin (BSA)/PBS buffer (Sigma-Aldrich/Merck). The antibody mix containing the individually diluted metal-conjugated antibodies in 0.5% BSA/PBS was applied to the slides ...
-
bioRxiv - Microbiology 2023Quote: ... We used sterile-filtered 3 % bovine serum albumin (BSA heat shock fraction, pH 7, > 98 %, Merck) in 1 × Pierce PBS buffer (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Bioengineering 2024Quote: ... We then dissolved 100 μmol of N-ethyl-N’-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Merck, E7750) in 1 mL of MES buffer and added it to the beaker ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein mixtures were incubated with 40μl PBST washed Streptavidin agarose resin (50% slurry, 69203-3 Merck) and incubated for 2h at room temperature on a roller ...
-
bioRxiv - Neuroscience 2024Quote: ... a group of approximately 50 flies in a training tube alternately received 3-octanol (3OCT; Merck) and 4-methylcyclohexanol (4MCH ...
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Bioengineering 2024Quote: ... and the elution fractions were concentrated with Amicon Ultra centrifugal filter units (3 kDa, UFC800324, Merck) to a concentration of 0.24 mg/mL (3.6 µM) ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by incubation with 200 µl of blocking solution [3% bovine serum albumin (BSA) (10735086001; Merck) in PBS-T at 37 °C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein mixture was concentrated using Amicon Ultra 3 kDa MW cut-off device (Merck Millipore) to ∼15 mg/ml and used to set up commercial crystallisation screens using the sitting drop vapour diffusion method at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fresh samples were attenuated in 2% low gelling temperature agarose (Merck) and cut into 350µm thick slices using the McIlwain tissue slicer (Campden Instruments) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Decalcification was performed with 2 ml of Osteosoft reagent (Merck Millipore) at 37°C for 5 days ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mixture (2:1 v/v) of (PFA 4% (Merck, 104005) in PBS 1X pH7.4):OCT (Leica Surgipath ...
-
Epicardial slices: a 3D organotypic model for the study of epicardial activation and differentiationbioRxiv - Bioengineering 2020Quote: ... and nuclei staining with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 10 minutes at RT ...
-
bioRxiv - Biochemistry 2020Quote: ... 6.25 mM TCEP (tris(2-carboxyethyl)phosphine) (Merck Millipore, Burlington, USA), 0.625 mM TBTA (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine ...
-
bioRxiv - Cell Biology 2021Quote: ... SV40 T Antigen (Ab-2) (Merck Millipore; DP02; 5 μg/ml). Secondary antibodies (all from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were selected with 2 µg/mL with Puromycin (#P8833, Merck) for 48 h ...
-
bioRxiv - Cell Biology 2021Quote: ... TEER was measured with the Millicell ERS-2 Voltohmmeter (Merck Millipore). TEER values (Ω cm2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 μg of normal rabbit IgG (Merck, Cat# 12-370, RRID:AB_145841), anti-mCherry (mCh ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were incubated overnight then treated with 2 mM thymidine (Merck) for 24 h ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (all Merck). The oxygen consumption rate (OCR ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, Merck) for 10 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and stained with 2 % pararosaniline solution (Sigma Aldrich/Merck, Poznan, Poland) for 5 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Merck, Darmstadt, Germany, 1 mM) dissolved in PBS was added to each well and the plate was placed in the dark for 10 min at room temperature for cell uptake ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Staining was performed using 2% Giemsa solution (Merck, 1.109204, Kenilworth, USA)/Giemsa buffer (pH6.8 ...
-
bioRxiv - Biochemistry 2020Quote: Titration assays using the high-affinity inhibitor MLi-2 (Merck, USA) were performed to determine the active protein concentrations of the LRRK2RCKW variants ...
-
bioRxiv - Neuroscience 2020Quote: ... chicken anti-microtubule-associated protein 2 (MAP2; 1:2000; Chemicon/Merck), and guinea pig anti-vesicular glutamate transporter 1 (VGLUT1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The suspension was filtered through 2 layers of Miracloth (Merck Millipore) into 50 ml Falcon tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... CtXPB was expressed in Rosetta™ 2 (DE3) cells (Merck Millipore), ctXPD was expressed in ArcticExpress (DE3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and Benzonase Nuclease (100 U/ml; Merck Millipore). Lysates were cleared by centrifugation at 14,000 rpm for 15 minutes ...
-
bioRxiv - Genomics 2020Quote: ... fish were anesthetized in 2-phenoxyethanol (300 ppm; Merck; 807291; USA). Recovery was performed in a separate tank with provision of air before fish returned to their holding tank ...
-
bioRxiv - Immunology 2020Quote: ... and 0,1 % (v/v) 2-mercaptoethanol (ß-ME, Merck, Darmstadt, Germany). B cell cultures were maintained by 37°C containing 5% CO2.
-
bioRxiv - Immunology 2021Quote: ... TILs were incubated with mouse IL-2 (mIL2-Ref: 11271164001-MERCK) 100U/ml in DMEM medium containing 10% FBS and 1% Penicillin/Streptomycin at 37°C for 2 days ...
-
bioRxiv - Cell Biology 2021Quote: ... Treatment with 2 µM hydrogen peroxide for 5 min (H2O2; Merck) was used to induce DNA strand-breaks and oxidative damage ...
-
bioRxiv - Cell Biology 2023Quote: MUC17(7TR) Caco-2 cells grown on Transwell filters (CLS3496, Merck) for 7 ...
-
bioRxiv - Immunology 2022Quote: ... Sections were incubated with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 20 min ...
-
bioRxiv - Immunology 2023Quote: ... and human rIL-2 (30 U/ml) (Roche/Merck, Darmstadt, Germany) to the culture ...
-
bioRxiv - Microbiology 2023Quote: N,N,N’,N’-tetrakis-(2-pyridylmethyl)ethylenediamine (TPEN) (Merck, 616394), made up in DMSO and used at 5 µM ...
-
bioRxiv - Biochemistry 2023Quote: ... the cells were discarded and N-ethyl-maleimide (Merck, 2 mM) and Pefabloc (Roth ...
-
bioRxiv - Molecular Biology 2022Quote: ... concentrated to 2 ml volume in Amicon Ultra-15 concentrators (Merck), and injected on a HiLoad 16/600 Superdex 75 pg (Cytiva ...