Labshake search
Citations for Merck :
651 - 700 of 751 citations for Recombinant Mouse Il17ra His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... insulin and proglucagon were measured using the Luminex™ Mouse Metabolic Hormone Expanded kit (Merck & Co., Inc. Kenilworth, NJ). Also ...
-
bioRxiv - Molecular Biology 2023Quote: ... This was followed by application of a Cy3-conjugated goat anti-mouse antibody (1:250 dilution, #AP124C; Merck Millipore) as the secondary antibody ...
-
bioRxiv - Microbiology 2024Quote: ... Whole cell samples were then analysed by immunoblot using anti-puromycin antibody (1:2000, anti-mouse, clone 12D10, Merck). As a loading control a duplicate SDS-PAGE was performed ...
-
bioRxiv - Molecular Biology 2023Quote: ... PLA was performed using Duolink In Situ Red Starter kit (Mouse/Rabbit) according to the manufacturer protocol (Merck, DUO92101).
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with FITC (Fluorescein isothiocyanate) conjugated secondary antibody (0.5 μg/ml of Goat Anti-Mouse IgG-FITC in 5%BSA) (GeNei, Merck, USA) (Cat.no ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary antibodies were detected with HRP-conjugated anti-rabbit or anti-mouse IgG and visualised with Immobilon Western HRP substrate (Merck).
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed once and then incubated with the appropriate fluorescently labelled secondary antibody (anti-mouse polyvalent Ig-FITC (Merck) or anti-His6 HIS.H8 DyLight 488 ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibodies, anti-rabbit IgG-HRP (1:5000, #7074, CST) or anti-mouse-HRP (1:10000, #12-349, Merck Millipore) in TBST containing 5% milk for 1 h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at room temperature in darkness with the primary antibody solution containing mouse anti-vesicular Glutamate Transporter 1 (vGLUT1, 1:1000, MAB5502, Merck) or rabbit anti-Glutamate Decarboxylase 65-67 (GAD 65-67 ...
-
bioRxiv - Neuroscience 2020Quote: ... The blots were blocked in PBS/ 0,05%Tween20 containing 5% skim milk and then probed with the following primary antibodies over night at 4°C: mouse anti-P53 (1:100, Merck), rabbit anti-H2AX (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... blocked with 10% bovine serum albumin (BSA) 30 min at 37°C and incubated with primary anti-γH2A.X mouse antibodies (Merck Millipore) or rabbit anti-LC3B antibodies (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse LL/2 (LLC1; ATCC no. CRL-1642; obtained in 2015) was grown in BME with Earle′s salts (Merck) with the same supplementation as mentioned above ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Sections containing SN and VTA were incubated with antibodies directed against tyrosine hydroxylase (mouse monoclonal, 1:1000, Merck-Millipore MAB318) and mCherry (rabbit polyclonal ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at room temperature in darkness with the primary antibody solution containing mouse anti-vesicular Glutamate Transporter 1 (vGlut1, 1:1000, MAB5502, Merck) and rabbit anti-Glutamate Decarboxylase 65-67 (GAD 65-67 ...
-
bioRxiv - Cell Biology 2022Quote: ... and SDS-PAGE and immunoblots were performed by standard methods using a mouse monoclonal anti-MYC antibody (clone 4A6, 05-724, Merck).
-
bioRxiv - Bioengineering 2020Quote: ... or mouse monoclonal β-actin antibody (1:1000 dilution; catalog no. catalog no. MAB 1501; Merck Millipore, Burlington, MA, USA) at room temperature for 1 hour ...
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by washing and staining with horseradish peroxidase-conjugated donkey anti-rabbit or anti-mouse IgG secondary antibodies (1:5,000 dilution; Merck Millipore), respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... AB5543), chicken anti-β3 tubulin (1:500, AB9354) and mouse anti-ankyrin G (1:500, MABN466) were purchased from Merck Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000, Merck Millipore ...
-
bioRxiv - Genetics 2021Quote: ... a mouse anti-glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody (#MAB374, used at 1:10,000 for the Western blot analyses, Merck Millipore); a rabbit anti-LC3B polyclonal antibody (#2775 ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following antibodies were used for ChIP analysis: Mouse anti-RNA polymerase II antibody clone CTD4H8 (Merck Millipore, 05-623), Rabbit anti-NF-kB p65 antibody clone D14E12 (Cell Signalling ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were run on SDS-PAGE and the expression of IDO1 was analyzed with a mouse anti-IDO1 antibody (clone 8G-11, Merck). Mouse monoclonal Ab against β-tubulin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation with a rabbit anti-Kv4.3 primary antibody (1:10000, Alomone Labs) together with chicken (G)/mouse (L) anti-TH primary antibody (1:1000, Abcam / Merck) in a carrier solution (1% NGS ...
-
bioRxiv - Cell Biology 2023Quote: Proximity ligation assays with Aurora A kinase and MP-GAP were performed in HeLa cells using mouse anti-Aurora A Kinase antibody (1:500, A1231 Merck), rabbit anti-MP-GAP antibody (1:250 ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... the fixation procedure above with and without subsequent membrane permeabilization was used in infected/uninfected organoids that were then stained with a mouse monoclonal anti-mitochondria antibody Cy3 conjugate (Merck) incubated overnight at 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... Then these samples were incubated in Alexa Fluor 488 conjugated mouse monoclonal anti-CTSK antibody (1:100) at 4°C overnight (Merck) and then for 1h under agitation at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated overnight with an anti-GFP rabbit antibody (0.5 μg/ml) (Tamamaki et al., 2000) and an anti-Cre recombinase mouse monoclonal antibody (1:1,000; MAB3120, Merck Millipore). After a rinse ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:10,000 WB) and mouse monoclonal antibody recognizing the N-terminus β-Actin (#A5441, 1:10,000 WB) were purchased from Merck. Rabbit polyclonal phosphomyosin (Thr18/Ser19 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... CDK9 was immunoprecipitated with 15μg of an anti-CDK9 antibody (D-7, sc-13130, lot no # B1422) or control mouse IgG (12-371, Merck) in IP Buffer with 2X SDS buffer (100mM NaCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... one mouse was exposed by drinking water to a mixture of BPA (1 µM, CAS no. 80-09-1, Merck) and DEHP (1 µM ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were incubated with secondary antibodies conjugated with PLA probes MINUS and PLUS: the PLA probe anti-mouse PLUS and anti-rabbit MINUS (Merck). Incubation with all antibodies was accomplished in a humidified chamber for 1 h at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... The antibody was revealed using Atto 594 goat anti-mouse IgG (1:500, 76085-1ML-F, Merck & Co., Kenilworth, NJ, USA). The coverslips were rinsed in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked in 5% skim milk in TBS for 1 hour and probed with mouse γ/9d 2G10.2 (1:1000, MERCK MABT1335), rabbit anti mouse IgG (1:3000 ...
-
bioRxiv - Immunology 2021Quote: ... Mouse peritoneal macrophages (MPMs) were isolated from mice 4 d after the intraperitoneal injection of thioglycollate (Merck & Co.; Kenilworth, NJ, USA) as described previously(Zhang et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were collected in PBS in 24-well plates and processed for free-floating immunofluorescence using primary polyclonal antibodies that label neurons (NeuN, mouse; 1: 1000, Millipore MAB377, Merck Millipore), reactive astrocytes (GFAP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the slides were incubated for 1 h at room temperature with the appropriate biotin-conjugated secondary antibody: goat anti-mouse (21538, Merck-Millipore) for CD3 and goat anti-rat (BP-9400 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were transferred to well-plates for exposure to two primary antibodies (RFP antibody 5F8 rat for mCherry, RRID: AB_2336064, Chromotek, 1:1000; and mouse-monoclonal anti-CaMKIIα, RRID: AB_309787, Merck Millipore, 1:300) which were added to 0.1 M PBS-Tx 0.2% containing 5% normal goat serum ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies were detected with horseradish peroxidase conjugated anti-rabbit and anti-mouse antibodies and visualized by enhanced chemiluminescence detection (Luminata Forte Western HRP substrate, Merck Millipore). Digital images were acquired on a ChemiDoc XRS System (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were centrifuged for 5 min at 20 000 x g and supernatants were immunoprecipitated for 1 h rotating at 4°C with mouse anti-GFP antibody (1 µg antibody per sample, 11814460001 Merck/Sigma) and 20 µl DynabeadsTM Protein G (10004D ...
-
bioRxiv - Biophysics 2022Quote: ... followed by incubation in LI-COR blocking buffer containing rabbit polyclonal anti-P2X2 (#APR-003, Alomone labs; 1:2000) and mouse anti-Na+/K+-ATPase (05-369; EMD Merck Millipore) at 4 °C overnight ...
-
bioRxiv - Immunology 2019Quote: ... and mouse monoclonal anti-DNA/Histona H1 antibody (1:100; catalog number 05-457/clone AE-4; Merck Millipore, MA, EUA). Alternatively ...
-
bioRxiv - Neuroscience 2021Quote: Immunohistochemical staining was performed on free-floating brain sections using the following primary antibodies: mouse anti-rat TH (1:4000, MAB318, Merck Millipore), rabbit anti-Girk2 (1:500 ...
-
bioRxiv - Immunology 2021Quote: ... blocked in 5% BSA for 30 min and incubated ON with mouse anti-GAD67 monoclonal antibody (1:6000, MAB5406, Merck Millipore) or 1 h with rabbit polyclonal anti-GAPDH antibody (1:3000 ...
-
bioRxiv - Cell Biology 2021Quote: ... Blots were incubated with goat anti-mouse horse radish peroxidase (HRP)-conjugated secondary antibody and the bands developed with Luminata Forte Western HRP Substrate (Merck Millipore).