Labshake search
Citations for Merck :
651 - 700 of 2761 citations for Anti Cullin 5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 1 ml of extract was incubated overnight at 4°C with rotation with 20 µg/ml anti-FLAG M2 antibody (Merck, F3165) and 50 µl Pierce magnetic protein A/G beads (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... the following primary antibodies or lectin were used: an anti-aggrecan rabbit antibody (1:4500 for DAB staining; 1:500 for fluorescence staining; AB1031, Merck Millipore), an anti-GABA chicken antibody (1:200 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the slides were incubated for 1 h at room temperature with the appropriate biotin-conjugated secondary antibody: goat anti-mouse (21538, Merck-Millipore) for CD3 and goat anti-rat (BP-9400 ...
-
bioRxiv - Microbiology 2020Quote: ... Fifty picomolar DNA were incubated with 50pM anti-digoxigenin-covered beads (antibody: Roche, #11093274910 and carboxylate-modified beads F1-XC030, Merck-Estapor) in Buffer A (PBS 1X ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were transferred to well-plates for exposure to two primary antibodies (RFP antibody 5F8 rat for mCherry, RRID: AB_2336064, Chromotek, 1:1000; and mouse-monoclonal anti-CaMKIIα, RRID: AB_309787, Merck Millipore, 1:300) which were added to 0.1 M PBS-Tx 0.2% containing 5% normal goat serum ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were subsequently washed with PBS and incubated for 2 h with the proper secondary antibodies (1:300, goat anti-rabbit Alexa-Fluor® 647, AP187SA6, Merck Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... Total β1-integrin was detected by immunoblotting the membrane again with clone N29 anti-β1-integrin antibody (Merck, MAB2252, 1:1000) and appropriate secondary antibody and analysis on the Odyssey (LI-COR ...
-
bioRxiv - Immunology 2019Quote: ... and mouse monoclonal anti-DNA/Histona H1 antibody (1:100; catalog number 05-457/clone AE-4; Merck Millipore, MA, EUA). Alternatively ...
-
bioRxiv - Genomics 2019Quote: ... ChIP was performed on this chromatin extract using 1 µL of Anti-acetyl-Histone H4 (Lys16) Antibody (Merck Milipore, 07-329) or 0.5 µL of Histone H3 antibody mAb MABI 0301 (Active Motif ...
-
bioRxiv - Neuroscience 2021Quote: Immunohistochemical staining was performed on free-floating brain sections using the following primary antibodies: mouse anti-rat TH (1:4000, MAB318, Merck Millipore), rabbit anti-Girk2 (1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... Blots were incubated with goat anti-mouse horse radish peroxidase (HRP)-conjugated secondary antibody and the bands developed with Luminata Forte Western HRP Substrate (Merck Millipore).
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then incubated overnight at 4°C in blocking solution containing one of the following primary antibodies: anti-GFAP (1:2000; Merck Millipore) and anti-Iba1 (1:500 ...
-
bioRxiv - Microbiology 2019Quote: For ChIP the following antibodies were used in this study: Rabbit polyclonal anti H3K9/K14-ac (Merck Millipore; Cat#06-599); Rabbit monoclonal anti H3K4-me3 (clone MC315 ...
-
bioRxiv - Genomics 2021Quote: Localization of resulting plasmids was assessed with immunofluorescence staining using an anti-flag antibody (F7425, Sigma Aldrich, Merck, Kenilworth, NJ, USA) in combination with Alexa 546 secondary antibody (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were placed in fresh buffer PBS-T-milk for 1h (or 1h30 when performing the LTAs western blot in parallel) with the polyclonal rabbit anti-PBP2B antibody (at 1:5000, lab. stock or available at Merck ABS2199), the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... The pre-cleared lysates were then incubated overnight at 4°C with polyclonal rabbit anti-TipR antibodies (1:400 dilution) (Kirkpatrick and Viollier, 2014) or monoclonal rabbit anti-HA antibodies (1:250 dilution) (Clone 114-2C-7, Merck Millipore). ...
-
bioRxiv - Plant Biology 2022Quote: ... 15 cycles of 30 s on and 30 s off) and immunoprecipitated using an anti-GFP antibody (Sigma-Aldrich; Merck KGaA). The immunoprecipitated and purified DNA was used for quantitative real-time PCR ...
-
bioRxiv - Pathology 2023Quote: ... blocked with normal serum for 1 h at 22–24°C and incubated overnight at 4°C with rabbit polyclonal anti-Lubricin antibody (1:500, MABT401, MERCK, DEU). The sections were then washed three times with PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Retinae were incubated overnight on a rocker at 4 °C with appropriate combinations of the following antibodies: guinea pig anti-RBPMS (1:300, catalog no. ABN1376; Merck Millipore); goat anti-Brn3a (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... Retinae were incubated overnight on a rocker at 4 °C with appropriate combinations of the following antibodies: guinea pig anti-RBPMS (1:300, catalog no. ABN1376; Merck Millipore); goat anti-Brn3a (1:100 ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were washed in PBS for 3 times and Alexa Fluor 555 conjugated secondary goat anti-mouse IgG antibody (1:100; Merck, Germany) was added for immunostaining in the dark for 2 hours at RT ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated in a 10% (v/v) HS PBS solution supplemented with primary mouse anti-β-tubulin III antibody (1:100; Merck) overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then incubated for 1 hour at room temperature with the anti-NOTCH1 primary antibody (Merck Life Sciences, Cat #: SAB4200024) diluted at 1:350 in 1% BSA blocking solution ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were permeabilized with 100% ice-cold methanol for 20 min at -20°C and rehydrated by washing with PBS and then stained for viral hexon protein expression with an anti-hexon primary antibody (mouse; Merck; #MAB8052) and an anti-mouse secondary antibody coupled to AF488 or AF647 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 1:100, in-house antibody SCV-1E8 (Morgan et al., 2023)) in conjunction with either anti-NeuN (chicken, 1:3000, Merck, ABN91), anti-Iba1 (rabbit ...
-
bioRxiv - Plant Biology 2024Quote: ... and 160 U/mL SUPERase•In™ RNase Inhibitor) and incubated with anti-FLAG® antibody magnetic beads (Merck, Cat# M8823) overnight at 4°C with gentle rotation ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibody (Merck guinea pig anti-NeuN 1:1000 ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Microbiology 2019Quote: ... For experiments using 5-FAM-rifampicin (Merck-Millipore), MLP or persistence phase cells were exposed to 1.5 µg/ml (concentration equimolar to 10x MBC rifampicin ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... using spin filters (Merck, Millipore, MWCO: 5 kDa).
-
bioRxiv - Neuroscience 2020Quote: ... 5% aluminum sulfate solution (Merck Millipore, ref. 1.00121) for 5 min ...
-
bioRxiv - Microbiology 2019Quote: ... Mounted cells were fixed in 5% glutaraldehyde (Merck) in 0.1 M cacodylate (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% BSA (Merck KGaA) in TBS (Merck KGaA ...