Labshake search
Citations for Merck :
601 - 650 of 1414 citations for 6 CHLOROPURINE RIBOSIDE 5' O MONOPHOSPHATE SODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Slides were later stained with 5% Giemsa (Merck) for 4 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with benzonase (5 μL/g pellet, Merck) and incubated for 15 min on a shaking table ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were suspended in 5% BSA (Merck; #12659) in PBS and single cells were sorted using a BD FACSJazz system into wells of a 96-well cell culture plate ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescein-labelled ssDNA substrate (5’[FAM]-pT50; Merck) was used in all SEC experiments to allow us to characterise complexes formed on DNA in the absence of any unwinding.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 % heat-inactivated horse serum (Merck), EGF (20 ng mL−1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). At least 3 independent experiments with at least 2 independent littermate MEF clones of each genotype and each sex were performed to measure DNA damage responses ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). Four independent experiments were performed.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Neuroscience 2022Quote: ... cells nuclei were stained with DAPI (4′,6-diamidino-2-fenilindol, 1:10000, Merck, cat#D9542) for 5 minutes at RT and mounted in Lab Vision™ PermaFluor™ Aqueous Mounting Medium (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... and 6) enzymatic reaction to reveal peroxidase with Sigma Fast 3,3’-diaminobenzidine (Merck KGaA, Darmstadt, Germany) used as substrate ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then incubated with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; Merck Millipore) and mounted on slides with Mowiol (Merck Millipore ...
-
bioRxiv - Bioengineering 2023Quote: ... and 6 mg/ml 2000 kDa Fluorescein isothiocyanate–Dextran (FITC-Dextran; 46946, Merck, Kenilworth, NJ, USA) (4 ml/kg ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were tested every 6-12 months either by PCR (LookOut kit, Sigma/Merck) or Mycostrips (Invivogen ...
-
bioRxiv - Molecular Biology 2024Quote: 6 mL bone extraction buffer (1 M Trizma base, 0.1 M NaCl, 50 mM TitriplexIII (Merck), 0.5% SDS (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... counterstained with 5µg of 4’,6-diamidino-2-phenylindole (DAPI – 1:1) (Sigma/Merck, D9542-10mg) to eliminate dead cells before running through the flow cytometer ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Molecular Biology 2019Quote: To evaluate microscopic features of the captured cells such as morphological types and possible alterations we then used another collection membrane directly stained with hematoxylin and eosin after fixation for 10 min in a fixation solution (100 mL of 70% ethanol, 5 mL of glacial acetic acid and 5 mL of 37% formaldehyde solution – all solutions are from Merck Millipore). Samples were hydrated with distilled water for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Microbiology 2021Quote: ... A total of 20 µg of protein from each sample was subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to the polyvinylidene difluoride (PVDF) membrane (Merck Millipore, USA). Then ...
-
bioRxiv - Genomics 2021Quote: ... Then the mixture was incubated at 37°C for 16 hours by adding 100µg of Ampicillin (Serva, 69-52-3) and 50µg of sodium azide (Merck Millipore,26628-22-8). After the enzyme digestion ...
-
bioRxiv - Neuroscience 2020Quote: ... subjects were given an overdose of sodium pentobarbital (Beuthanasia-D Special, 22 mg/100g body weight, Merck Animal Health, Madison, NJ, USA). Once at surgical plane ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were fractionated on 8% (w/v) sodium dodecyl sulfate polyacrylamide gels and transferred to Immobilon®-P PVDF Membrane (Merck, IPVH00010). Membranes were incubated in 5% (w/v ...
-
bioRxiv - Microbiology 2019Quote: ... 100 μL of the faeces mixture was added to 10 mL of Selenite Broth (19 g/L selenite broth base, Merck, UK, 70153-500G and 4 g/L sodium hydrogen selenite, Merck 1.06340-50G) and incubated overnight at 37°C with shaking at 220 rpm ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were administered a lethal dose of sodium pentobarbital and transcardially perfused with Ringer’s solution followed by paraformaldehyde (PFA, 4 %, Merck Millipore, Darmstadt, Germany) in 125 mM phosphate buffer (PB) ...
-
bioRxiv - Neuroscience 2022Quote: ... Subjects were given an overdose of sodium pentobarbital (Beuthanasia-D Special, 22 mg/100g body weight, Merck Animal Health, Madison, NJ, USA). Once at surgical plane ...
-
bioRxiv - Plant Biology 2023Quote: ... Total proteins were separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene fluoride membranes (Merck Millipore, USA). OsJMT1-HA was detected by immunoblotting with HRP-conjugated anti-HA monoclonal antibodies (1:2,000 ...
-
bioRxiv - Microbiology 2023Quote: ... K2HPO4 2.9 g/l, VWR; di-ammonium citrate 0.7 g/l, Sigma-Aldrich; sodium acetate 0.26 g/l, Merck; glucose 1% (w/v), Merck ...
-
bioRxiv - Microbiology 2023Quote: ... K2HPO4 2.9 g/L, VWR; di-ammonium citrate 0.7 g/L, Sigma-Aldrich; sodium acetate 0.26 g/L, Merck; glucose 1% (w/v), Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... #808259), potassium chloride (KCl, #104935), potassium phosphate dibasic (K2HPO4, #104873), and sodium phosphate dibasic (Na2HPO4, #106585) was purchased from Merck (Darmstadt, Germany). Sodium chloride (NaCl ...
-
bioRxiv - Neuroscience 2023Quote: ... subjects were given an overdose of sodium pentobarbital (Beuthanasia-D, 22 mg/100 g body weight, Merck Animal Health, Madison, NJ, USA) and then transcardially perfused with approximately 250 mL of 25mM phosphate buffered saline (PBS ...
-
bioRxiv - Biophysics 2020Quote: ... Then His-tag containing OpuAC was introduced to the flow cell (in buffer B supplemented with 10 mM of (±)6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox; Merck) as a photostabilizer[20] ...
-
bioRxiv - Immunology 2022Quote: ... IL-6 and IL-1RA was performed using the Luminex color-coded antibody-immobilized beads from Merck Millipore following the manufacture’s indications ...
-
bioRxiv - Cell Biology 2022Quote: Stress assays (wounding or uraemic serum addition) were performed in Corning® 6-well plates (Merck, UK). The HDF ...
-
bioRxiv - Biophysics 2019Quote: ... Measurements were done in buffer A supplemented with 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Merck) and 10 mM Cysteamine (Merck).
-
bioRxiv - Cancer Biology 2021Quote: ... cultures were treated with 4 μM of the CDK4/6 inhibitor Palbociclib/PD-0332991 (Merck, PZ-0199) for 8 days ...
-
bioRxiv - Immunology 2022Quote: ... Transfections were carried out in 6 well plates with cells at 50–70% confluency using GeneJuice (Merck) with 1 μg of total plasmid DNA per well ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1/1000 dilution or Laurdan (#40227, 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine, Merck, Sigma-Aldrich) at 1/500 dilution for 30 min at 37°C in the dark ...
-
bioRxiv - Developmental Biology 2023Quote: ... gastruloids were incubated with secondary antibodies and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: Trypsinise Ara-C purified SCs using 1 ml of 6% 2 mg ml-1 Trypsin (Merck - 85450C) in Versene (0.02% EDTA (Thermo Fisher - D/0700/53 ...
-
bioRxiv - Cancer Biology 2024Quote: ... we plated BC cells (3x105 cells in a 6 well-plate) embedded in collagen type ӏ (Merck) to mimic the breast ECM.
-
bioRxiv - Neuroscience 2020Quote: ... fillet dissections of L3 larvae or pharate adults were performed in modified HL3 solution ([HL3-EGTA] 70 mM NaCl, 5 mM KCl, 10 mM NaHCO3, 20 mM MgCl2, 5 mM trehalose (Merck KGaA, 108216), 115 mM sucrose (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by embedding in 5 % low melting agarose (Merck). Gelatinated blocks were washed in 0.1 M Soerensen’s phosphate buffer (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5% (v/v) Donkey serum (Merck Millipore, S30-100ML) for more than 1h at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C and samples were eluted with 5 mM H2SO4 in water at a 0.3 ml/min flow rate.
-
bioRxiv - Genetics 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 80 °C ...