Labshake search
Citations for Merck :
601 - 650 of 2559 citations for 5 Pyrimidinecarbonitrile 2 4 diamino 6 methoxy 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Physiology 2023Quote: ... and 6) enzymatic reaction to reveal peroxidase with Sigma Fast 3,3’-diaminobenzidine (Merck KGaA, Darmstadt, Germany) used as substrate ...
-
bioRxiv - Bioengineering 2023Quote: ... and 6 mg/ml 2000 kDa Fluorescein isothiocyanate–Dextran (FITC-Dextran; 46946, Merck, Kenilworth, NJ, USA) (4 ml/kg ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were tested every 6-12 months either by PCR (LookOut kit, Sigma/Merck) or Mycostrips (Invivogen ...
-
bioRxiv - Molecular Biology 2024Quote: 6 mL bone extraction buffer (1 M Trizma base, 0.1 M NaCl, 50 mM TitriplexIII (Merck), 0.5% SDS (Life Technologies ...
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Molecular Biology 2019Quote: To evaluate microscopic features of the captured cells such as morphological types and possible alterations we then used another collection membrane directly stained with hematoxylin and eosin after fixation for 10 min in a fixation solution (100 mL of 70% ethanol, 5 mL of glacial acetic acid and 5 mL of 37% formaldehyde solution – all solutions are from Merck Millipore). Samples were hydrated with distilled water for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Microbiology 2021Quote: ... A total of 4 mL of the wash was extracted and placed in a Amicon® Ultra-4 Ultracel®-50k (Merck Millipore Ltd.) filter tube and centrifuged for 7 minutes at 7000 rpm ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-(1H-Indol-3-yl)-4-oxo-4-phenyl-butyric acid (PEO-IAA; OlChemIm, Olomouc, Czech Republic) and indole-3-carbinol (I3C; Sigma-Aldrich, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Microbiology 2020Quote: ... TarP or TarM (6.3 μg/ml) for 2 hours at room temperature with UDP-GlcNAc (2 mM, Merck) in glycosylation buffer (15 mM HEPES ...
-
Controlled Fluorescent Labelling of Metal Oxide Nanoparticles for Artefact-free Live Cell MicroscopybioRxiv - Biophysics 2021Quote: ... centrifugal filter device Amicon Ultra 4 mL 100K (Merck Millipore), HCl (Merck) ...
-
bioRxiv - Cell Biology 2020Quote: ... in 20 µl reactions containing 4 mM ATP (#1191, Merck), 150 mM NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... The sections were stained with 4% uranyl acetate (Merck, Germany) and 2% methylcellulose at a ratio of 1:9 (on ice) ...
-
bioRxiv - Cell Biology 2020Quote: Cells plated on coverslips were fixed with 4% paraformaldehyde (Merck) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 4 mM L-gluta-mine (Merck KGA, Germany). Virus stocks were frozen at –80°C and virus titers were determined by TCID50 assay.
-
bioRxiv - Developmental Biology 2021Quote: ... the lungs were fixed in 4% paraformaldedyde (PFA; Merck, 158127) overnight ...
-
bioRxiv - Developmental Biology 2022Quote: Pituitary and organoids were fixed in 4% paraformaldehyde (PFA; Merck) and embedded in paraffin using the Excelsior ES Tissue Processor (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... or 4 μg of H3K27me3 antibody (17-622, Merck Millipore).
-
bioRxiv - Cancer Biology 2020Quote: For immunohistochemistry tissues were fixed in 4% Formaldehyde solution (Merck) and subsequently embedded in paraffin ...
-
bioRxiv - Pathology 2021Quote: ... 4°C and filtered with a 0.45μm filter (Merck, Germany). MLNs were mashed by sliding two glass slides together ...
-
bioRxiv - Microbiology 2022Quote: ... Coverslips were mounted using Mowiol®4-88 (Calbiochem, Merck). Infected cells were counted with a Leica DMR microscope (40X magnification).
-
bioRxiv - Cancer Biology 2022Quote: ... each sample was placed into an Amicon-Ultra 4 (Merck) centrifugal filter unit and detergents were removed by several washes with 8M urea ...
-
bioRxiv - Neuroscience 2022Quote: ... and with 4% paraformaldehyde (Merck Millipore, Merck KGaA, Darmstadt, Germany). Brain-samples were afterwards surgically removed and post-fixed in 4% paraformaldehyde for 4h ...
-
bioRxiv - Molecular Biology 2019Quote: ... The sections were stained with 4% uranyl acetate (Merck, Germany) and 2% methylcellulose in a ratio of 1:9 (on ice) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 % Triton-X and 1x BugBuster (Merck Millipore, #70584-4) were added to lyse the bacteria for 30 min at 4 °C with gentle rotation ...
-
bioRxiv - Cell Biology 2021Quote: Cells were fixed with 4% (v/v) formaldehyde (Merck, 47608) diluted in PBS for 15 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... anti-H3K27me3 (Merck Millipore, 07-449, 4 μl per ChIP), anti-H3K27ac (abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... without insulin (RB-) 4 μM CHIR99021 (Merck Millipore Sigma, USA). After 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 µl 0.6 M NaBH3CN (Merck) to the “light” and “medium” or 4 µl of 0.6 M NaBD3CN (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... containing 4% cellulose Onozuka R-10 (Merck, http://www.merck-chemicals.com) and 2.0 % pectinase (Sigma-Aldrich ...
-
bioRxiv - Genetics 2022Quote: ... they were treated with 200nM 4-hydroxy tamoxifen (Merck Millipore) to activate CreER recombination which results in cells becoming Δ/+ (fl/+ cells become Adar1 heterozygous ...
-
bioRxiv - Bioengineering 2022Quote: ... before they were fixed with 4% Paraformaldehyde (PFA #30525894, Merck) in PBS for 30 minutes at RT.
-
bioRxiv - Microbiology 2022Quote: ... 50 mg/ml L-cysteine (Merck Cas#52-90-4), 5 mg/ml Hemin (Mercury Cat#3741 ...
-
bioRxiv - Neuroscience 2022Quote: Cell media was removed and replaced with 4% paraformaldehyde (Merck) diluted in 1×PBS ...
-
bioRxiv - Plant Biology 2022Quote: ... and concentrated by Amicon Ultra-4 Centrifugal Filter Unit (Merck).
-
bioRxiv - Cancer Biology 2023Quote: ... USA and Fenretinide (4-Hydroxyphenylretinamide) (390900) was purchased from Merck, Germany ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cultures were fixed with 4% paraformaldehyde (Sigma-Aldrich, Merck) for 30 min and washed with distilled water ...
-
bioRxiv - Biophysics 2023Quote: ... The brains were then fixed with 4% PFA (#30525894, Merck) in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... femurs were embedded in 4% low-gelling temperature agarose (Merck) and sectioned with a vibratome (Leica VT1200 S ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 7.4) and 4% paraformaldehyde (PFA, in PBS, Merck-Aldrich) was executed ...
-
bioRxiv - Neuroscience 2023Quote: ... or mPAGE 4-12% Bis-Tris Precast gels (#MP41G10, Merck). Separated proteins were then transferred to PVDF or Nitrocellulose membranes according to manufacturer’s instructions (Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... and α-cyano-4-hydroxycinnamic acid (α-CHCA) from Merck KGaA (Darmstadt ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM TCEP with 4% SYPRO Orange dye (Merck, #S5692) were filtered in SpinX tubes (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4 μg of normal mouse IgG (MOPC21; Merck Millipore) overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... concentrated using a centrifugal filter unit (Amicon Ultra-4; Merck), frozen in LN2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-Sox9 (Merck, AB5535; 2 μg/ml); anti-Tfap2a (DSHB ...
-
bioRxiv - Developmental Biology 2021Quote: ... containing 2 mM calcium chloride (Merck, C27902) overnight at 4°C ...