Labshake search
Citations for Merck :
601 - 650 of 2822 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... using spin filters (Merck, Millipore, MWCO: 5 kDa).
-
bioRxiv - Neuroscience 2020Quote: ... 5% aluminum sulfate solution (Merck Millipore, ref. 1.00121) for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% BSA (Merck KGaA) in TBS (Merck KGaA ...
-
bioRxiv - Biochemistry 2020Quote: ... Slides were later stained with 5% Giemsa (Merck) for 4 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with benzonase (5 μL/g pellet, Merck) and incubated for 15 min on a shaking table ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were suspended in 5% BSA (Merck; #12659) in PBS and single cells were sorted using a BD FACSJazz system into wells of a 96-well cell culture plate ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescein-labelled ssDNA substrate (5’[FAM]-pT50; Merck) was used in all SEC experiments to allow us to characterise complexes formed on DNA in the absence of any unwinding.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 % heat-inactivated horse serum (Merck), EGF (20 ng mL−1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). At least 3 independent experiments with at least 2 independent littermate MEF clones of each genotype and each sex were performed to measure DNA damage responses ...
-
bioRxiv - Biochemistry 2024Quote: ... Blocking with 5% bovine serum albumin (Merck, 126575) was used for rabbit anti-LC3B-I/II (1:3000 ...
-
bioRxiv - Systems Biology 2024Quote: ... (5) Pronase (Merck, CAS-No 9036-06-0) at a concentration of 1:100 in E3 1x medium is added at 20 hpf to remove the chorion [83] ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Cancer Biology 2024Quote: ... and non-specific binding was blocked with 5% milk powder or 5% bovine serum albumin (BSA) in tris-buffered saline containing 0.05% Tween-20 (Merck, Darmstadt, Germany). Blots were incubated overnight with mouse anti-gp130 (R&D systems ...
-
bioRxiv - Microbiology 2021Quote: ... A total of 4 mL of the wash was extracted and placed in a Amicon® Ultra-4 Ultracel®-50k (Merck Millipore Ltd.) filter tube and centrifuged for 7 minutes at 7000 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... TarP or TarM (6.3 μg/ml) for 2 hours at room temperature with UDP-GlcNAc (2 mM, Merck) in glycosylation buffer (15 mM HEPES ...
-
Microbial iCLIP2: Enhanced mapping of RNA-Protein interaction by promoting protein and RNA stabilitybioRxiv - Molecular Biology 2024Quote: ... 1% IGEPAL CA-630, 0.1% SDS, 0.5% sodium deoxycholate, 2 M urea, 2× Complete protease inhibitor EDTA-free [Merck, 11873580001] ...
-
Controlled Fluorescent Labelling of Metal Oxide Nanoparticles for Artefact-free Live Cell MicroscopybioRxiv - Biophysics 2021Quote: ... centrifugal filter device Amicon Ultra 4 mL 100K (Merck Millipore), HCl (Merck) ...
-
bioRxiv - Cell Biology 2020Quote: ... in 20 µl reactions containing 4 mM ATP (#1191, Merck), 150 mM NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... The sections were stained with 4% uranyl acetate (Merck, Germany) and 2% methylcellulose at a ratio of 1:9 (on ice) ...
-
bioRxiv - Cell Biology 2020Quote: Cells plated on coverslips were fixed with 4% paraformaldehyde (Merck) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 4 mM L-gluta-mine (Merck KGA, Germany). Virus stocks were frozen at –80°C and virus titers were determined by TCID50 assay.
-
bioRxiv - Developmental Biology 2021Quote: ... the lungs were fixed in 4% paraformaldedyde (PFA; Merck, 158127) overnight ...
-
bioRxiv - Developmental Biology 2022Quote: Pituitary and organoids were fixed in 4% paraformaldehyde (PFA; Merck) and embedded in paraffin using the Excelsior ES Tissue Processor (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: For immunohistochemistry tissues were fixed in 4% Formaldehyde solution (Merck) and subsequently embedded in paraffin ...
-
bioRxiv - Pathology 2021Quote: ... 4°C and filtered with a 0.45μm filter (Merck, Germany). MLNs were mashed by sliding two glass slides together ...
-
bioRxiv - Microbiology 2022Quote: ... Coverslips were mounted using Mowiol®4-88 (Calbiochem, Merck). Infected cells were counted with a Leica DMR microscope (40X magnification).
-
bioRxiv - Cancer Biology 2022Quote: ... each sample was placed into an Amicon-Ultra 4 (Merck) centrifugal filter unit and detergents were removed by several washes with 8M urea ...
-
bioRxiv - Neuroscience 2022Quote: ... and with 4% paraformaldehyde (Merck Millipore, Merck KGaA, Darmstadt, Germany). Brain-samples were afterwards surgically removed and post-fixed in 4% paraformaldehyde for 4h ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 % Triton-X and 1x BugBuster (Merck Millipore, #70584-4) were added to lyse the bacteria for 30 min at 4 °C with gentle rotation ...
-
bioRxiv - Cell Biology 2021Quote: Cells were fixed with 4% (v/v) formaldehyde (Merck, 47608) diluted in PBS for 15 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... anti-H3K27me3 (Merck Millipore, 07-449, 4 μl per ChIP), anti-H3K27ac (abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... without insulin (RB-) 4 μM CHIR99021 (Merck Millipore Sigma, USA). After 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 µl 0.6 M NaBH3CN (Merck) to the “light” and “medium” or 4 µl of 0.6 M NaBD3CN (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... containing 4% cellulose Onozuka R-10 (Merck, http://www.merck-chemicals.com) and 2.0 % pectinase (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... USA and Fenretinide (4-Hydroxyphenylretinamide) (390900) was purchased from Merck, Germany ...