Labshake search
Citations for Merck :
601 - 650 of 4558 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... The purified Nup98 was concentrated to a final concentration of 165 µM using 3-kDa MWCO centrifugal filters (Merck Millipore) in a solution of 2 M GdmCl ...
-
bioRxiv - Immunology 2023Quote: ... For intracellular cytokine labelling cells were incubated for 3 h at 37°C in RPMI-1640+10% FBS with PMA (50ng/ml, Merck), Ionomycin (1μg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The eluted aliquots were then desalted with filtered water and concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK) to remove any urea and salt residues.
-
bioRxiv - Biochemistry 2022Quote: ... as described by the manufacturer and dried down in a Speed-Vac concentrator (Thermo-Scientific) resuspended in 20 μl L/C water containing 3% acetonitrile (MeCN) (Merck) and 0.1% FA ...
-
bioRxiv - Biochemistry 2024Quote: Exoproteome fractions were concentrated to 1 mg mL-1 total protein (approximately 10 times concentration) using an Amicon Ultra-0.5 Centrifugal Filter Unit with a molecular weight cutoff of 3 kDa (Merck Millipore). A 10 µL aliquot of the concentrated exoproteome fraction was reduced with 5 mM tris (2-carboxyethyl ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Immunology 2024Quote: ... For intracellular cytokine labelling cells were incubated for 3 h at 37°C in RPMI-1640+10% FBS with PMA (50ng/ml, Merck), Ionomycin (1μg/ml ...
-
bioRxiv - Developmental Biology 2024Quote: ... the culture medium of the cells was replaced at day 3 with differentiation medium containing 10 mM PEG950 (Merck; P3515).
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed once in ice-cold PBS and then detached with ice-cold PBS containing Sigma Phosphatase Inhibitor Cocktail 3 (539134, Merck), CoMPLETE Protease Inhibitor tablets (11873580001 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... Target cells were transduced with 0.5 mL of viral supernatant in 3 mL of total medium supplemented with 8 µg/mL polybrene (Merck Sigma). 2 to 4 days post transduction ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Microbiology 2023Quote: ... Blood from the dissected abdomen was absorbed onto a 3 x 20 mm piece of a Whatman FTATM card (Merck) and placed in a 2 mL tube ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the peak fractions were pooled and concentrated using a 3 kDa molecular weight cut off (MWCO) spin concentrator (Merck). The concentration of the protein was measured via Bradford assay against a bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2023Quote: Bone marrow supernatants (0.5 mL per sample) were concentrated with 3 kDa MWCO Amicon Ultra Centrifugal filter devices (Merck Millipore) up to a final volume of 30 μL ...
-
bioRxiv - Neuroscience 2022Quote: ... microglia were isolated and cultured for 3 days as above before cells were lysed in RIPA buffer (60 μL/well, Merck). Next ...
-
bioRxiv - Bioengineering 2022Quote: ... the wells were rinsed 3 times with PBS and covered with 100 μL 0.5% (v/v) Triton-X 100 (Merck, 1.08603.1000) in PBS for 5 minutes to permeabilize cells ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were reseeded and enriched by selection in their respective media with an added 2.5 µg/ml of puromycin for B16-F1 and 3 µg/ml of puromycin (Merck # p9620) for Rat2 cells ...
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Neuroscience 2022Quote: ... slide-mounted OE sections or free-floating OB slices were washed with PBS and incubated in 3 % BSA (Merck, A2153) with 0.25 % triton and 0.02 % sodium azide (Severn Biotech Ltd ...
-
bioRxiv - Microbiology 2022Quote: ... Parasitemias were calculated from day 3 post-infection by counting infected red blood cells in blood smears stained with Hemacolor (Merck).
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... or 300 mM (octamer-mix + APLFAD) ammonium acetate at pH 7.5 using 3 kDa MWCO Amicon Ultra Centrifugal Filter Units (Merck Millipore). After buffer exchange the volume of each sample was ∼40 µL ...
-
bioRxiv - Neuroscience 2022Quote: Tissues or cells were homogenized in Pierce IP Lysis buffer supplemented with protease inhibitor cocktail 3 (Merck Millipore, Darmstadt, Germany) and phosphatase inhibitor PhosSTOP (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... Germany) followed by size-fractionation using a 3 kDa centrifugal filter according to the manufacturer’s instructions (Merck KGaA, Darmstadt, Germany). The samples were kept at 4 °C or on ice throughout the process ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the marine nanofibers were washed three times with 500 μL of ultrapure water using an Amicon Ultra-0.5 Centrifugal Filter Unit (3 kDa cutoff) (Merck Millipore). The collected marine nanofibers were dropped onto a copper grid ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purification of the labelled proteins was done by repeated filtration in a 3 kDa filter (Amicon Ultra-15 Centrifugal Filter Unit, Merck).
-
bioRxiv - Neuroscience 2024Quote: ... Slices were then washed in PBS and incubated in 0.2% Sudan black in 70% ethanol at room temperature for 3 minutes to minimize autofluorescence and mounted on glass slides (Menzel-Gläser) with FluorSave (Merck Millipore).
-
bioRxiv - Neuroscience 2024Quote: ... After washing 3 times for 10 minutes with PBS, slices were mounted on glass slides (J2800AMNZ, Epredia) with FluorSave (345789, Merck).
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Microbiology 2020Quote: ... were percussed until the amoebae detached and 1mL of the culture media was filtered through a 3 µm cellulose acetate membrane (Merck, Germany) to retain the A ...
-
bioRxiv - Genomics 2022Quote: ... in 3×250 ml bottles and resuspended in 100 ml prewarmed 30°C YPD supplemented with 50 ug/ml Pronase (Merck 10165921001), at which point the count-up for the time course was initiated ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins were transferred to 100 mM bicarbonate buffer (pH 8.2) by using Amicon® Ultra Centrifugal Filters (3 kDa MWCO, Merck, USA) and mixed with 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... rinsed four times with MTSB and treated for one hour at RT with 10% dimethylsulfoxide + 3% Igepal CA-630 (Merck # I3021) dissolved in MTSB ...
-
bioRxiv - Biochemistry 2022Quote: ... were combined and concentrated using an Amicon concentrator tube (30 kDa MWCO for the Nb- fused biosensors, 3 kDa MWCO for HER2-Nb) (Merck-Millipore). A final volume < 5 mL was loaded onto a SEC column (HiLoad 200pg ...
-
bioRxiv - Cell Biology 2022Quote: ... crescentus cultures were grown overnight at 30 °C in 3 ml of 2x PYE49 (Peptone, Merck, #82303; Yeast Extract, Merck, #Y1626) medium under mechanical agitation (200 rpm) ...
-
bioRxiv - Cell Biology 2022Quote: ... crescentus cultures were grown overnight at 30 °C in 3 ml of 2x PYE49 (Peptone, Merck, #82303; Yeast Extract, Merck, #Y1626) medium under mechanical agitation (200 rpm) ...
-
bioRxiv - Systems Biology 2022Quote: ... UK) previously coated with calf-skin collagen (15 μg/cm2 and fibronectin 3 μg/cm2; both Merck Life Science UK Ltd.). The permeability of hCMEC/D3 cell monolayers to 70 kDa FITC-dextran (2 mg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-DIV cultured human spinal motor neurons and C5-C7 ventral horns of adult animals 3 days after surgery were estimated using a Rac1/Cdc42 Activation Assay Kit (#17-441, Merck Millipore). Briefly ...
-
bioRxiv - Developmental Biology 2020Quote: ... membranes were washed 3 times with TBS-T and subjected to chemiluminescence detection with Immobilon Western Chemiluminescent HRP (Horseradish Peroxidase) Substrate (Merck Millipore) using a Gel-Doc XR+ System (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... Peptides were separated from the HLA molecule remnants by ultrafiltration employing 3 kDa and 10 kDa Amicon filter units (Merck Millipore) for HLA-I and HLA-II ...
-
bioRxiv - Microbiology 2020Quote: ... primers 1022700 5F and R were used to amplify the 572 bp 5’ homology flank and primer pair 1022700 3F and R was used to amplify the 673 bp 3’ homology flank (KOD Hot Start DNA Polymerase, Merck Millipore) which were cloned on either side of the sfGFP expression cassette in pkiwi003 (Ashdown et al. ...
-
bioRxiv - Microbiology 2020Quote: ... The media was further concentrated to ~3 ml with a 100 kDa cut-off centrifugal concentrator filter (Amicon Ultra, Merck Millipore) and layered onto a 20-60% w/v sucrose density gradient in PBS buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... bacteria were grown to mid-logarithmic phase at 37 °C in 3% (w/v) tryptic soy broth (Merck KGaA, Darmstadt, Germany). The microbial culture was washed twice by centrifugation and re-suspended in fresh 10 mM Tris buffer (pH 7.4 at 37 °C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Eluted protein samples were combined in one tube and desalinated using an ultrafiltration tube (Amicon Ultra 3 kDa molecular weight cut-off, Merck/Millipore) with Buffer C (50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...