Labshake search
Citations for Merck :
551 - 600 of 672 citations for FcgR4 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: PLAs were carried out using a Duolink® in situ red starter kit mouse/rabbit (Merck, Dorset, UK). HUVECs and spread platelets were fixed ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Cell Biology 2024Quote: ... cover slips were incubated with the primary antibody (SV40 T antigen mouse-anti-human, Merck-Millipore, 1:50) overnight at 4 °C in a humidifier chamber ...
-
bioRxiv - Immunology 2024Quote: ... plates were washed in PBS/T and incubated for 1 h with goat anti-mouse IgG-AP (Merck). Plates were then developed as per the mAb ELISA ...
-
bioRxiv - Immunology 2021Quote: ... The plates were then washed 5 times with HSWB followed by incubation of goat anti-mouse antibody (Merck, Germany) conjugated with HRP (diluted 1:3000 in LSWB + 1% BSA ...
-
bioRxiv - Physiology 2019Quote: ... Membranes were probed with the primary antibodies for puromycin (MABE343 anti-puromycin, clone 12D10 mouse monoclonal, Merck Millipore Limited), phosphorylated-4E-BP1 (Thr37/46) ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection of newly synthesized proteins was carried out by an anti-puromycin antibody (clone 12D10, mouse-monoclonal, MABE343; Merck), an anti-HuD antibody (ab96474 ...
-
bioRxiv - Neuroscience 2021Quote: ... The primary antibodies used were rabbit anti-CB1R (1:1,000, Immunogenes) and mouse anti-actin (1:50,000, MAB1501, Merck Millipore). Primary antibodies were detected with horseradish peroxidase conjugated anti-rabbit and anti-mouse antibodies and visualized by enhanced chemiluminescence detection (Luminata Forte Western HRP substrate ...
-
bioRxiv - Cell Biology 2021Quote: ... brain sections were subjected to immunohistochemistry using a mouse anti-NeuN antibody (MAB377; Merck, Kenilworth, NJ, USA; 1:500) followed by incubation with an anti-mouse IgG antibody (Vector Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Immuno-reactive complexes were detected using horseradish-peroxidase coupled anti-rabbit or anti-mouse antibodies (Sigma-Aldrich/Merck, Germany) and subsequent detection of chemiluminescence signals with a ChemoCam Camera system (INTAS Science instruments GmbH ...
-
bioRxiv - Microbiology 2022Quote: ... HRP-conjugated anti-goat or anti-mouse IgG (dilution 1:1,000) were added and protein complexes were visualized using o-phenylenediamine (Merck). The absorbance was then measured at 490 nm employing PowerWave HT (Bio-Tek Instruments ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies diluted in 5% milk/PBS-Tween were: mouse anti-Actin (1:2000; Merck, Germany, Cat. No. MAB1501), rat anti-MYC (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... Hybridization signals were detected using anti-mouse secondary antibodies conjugated with alkaline phosphatase using BCIP/NBT substrates (Merck Inc.).
-
bioRxiv - Microbiology 2022Quote: ... The sections were then incubated overnight in PBS with 0.2% BSA and 0.05% Tween-20 with primary antibodies directed against SARS-CoV-2 Nucleocapsid Protein (1:500; mouse monoclonal, # ZMS1075, Merck); Iba1 (1 ...
-
bioRxiv - Genetics 2021Quote: ... a mouse anti-actin monoclonal antibody (#MAB1501R, used at 1:5,000 dilution for the Western blot analyses, Merck Inc.); a mouse anti-glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody (#MAB374 ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and incubated overnight in the same solution with the primary antibody to CB1R (1:1,000, rabbit, Immunogenes) and neuronal nuclei (NeuN) (1:1,000, mouse, MAB377, Merck Millipore), at 4 °C ...
-
bioRxiv - Immunology 2021Quote: ... followed by incubation with a 1:5000 dilution of a donkey anti-mouse IgG HRP antibody (AP192P, Merck Millipore). Protein detection was performed using SuperSignal West Pico PLUS (34579 ...
-
bioRxiv - Physiology 2022Quote: ... monoclonal anti-α-actinin (Sarcomeric) antibody produced in mouse (1:1000, Sigma-Aldrich, Merck, clone EA-53, Cat# A7811), at 4°C overnight ...
-
bioRxiv - Genetics 2022Quote: ... followed by overnight incubation at 4°C with primary antibodies (Anti-ASL, Abcam ab97370, 1:1000; Anti-GAPDH mouse, Abcam ab8245, 1:10,000; Anti-nitrotyrosine, Merck 05-233 ...
-
bioRxiv - Neuroscience 2023Quote: ... The HRP-Conjugated secondary antibodies((Anti-Rabbit (raised in goat) and anti-Mouse (raised in goat)) were from Merck. ...
-
bioRxiv - Plant Biology 2023Quote: ... diluted 1:1000 in 1xTBST buffer (50 mM Tris, 150 mM NaCl, 0.1% Tween 20) and the anti-mouse secondary antibody (Merck) diluted 1:10000 in 1xTBST ...
-
bioRxiv - Microbiology 2023Quote: ... insulin and proglucagon were measured using the Luminex™ Mouse Metabolic Hormone Expanded kit (Merck & Co., Inc. Kenilworth, NJ). Also ...
-
bioRxiv - Molecular Biology 2023Quote: ... This was followed by application of a Cy3-conjugated goat anti-mouse antibody (1:250 dilution, #AP124C; Merck Millipore) as the secondary antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... PLA was performed using Duolink In Situ Red Starter kit (Mouse/Rabbit) according to the manufacturer protocol (Merck, DUO92101).
-
bioRxiv - Microbiology 2024Quote: ... Whole cell samples were then analysed by immunoblot using anti-puromycin antibody (1:2000, anti-mouse, clone 12D10, Merck). As a loading control a duplicate SDS-PAGE was performed ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with FITC (Fluorescein isothiocyanate) conjugated secondary antibody (0.5 μg/ml of Goat Anti-Mouse IgG-FITC in 5%BSA) (GeNei, Merck, USA) (Cat.no ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary antibodies were detected with HRP-conjugated anti-rabbit or anti-mouse IgG and visualised with Immobilon Western HRP substrate (Merck).
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed once and then incubated with the appropriate fluorescently labelled secondary antibody (anti-mouse polyvalent Ig-FITC (Merck) or anti-His6 HIS.H8 DyLight 488 ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibodies, anti-rabbit IgG-HRP (1:5000, #7074, CST) or anti-mouse-HRP (1:10000, #12-349, Merck Millipore) in TBST containing 5% milk for 1 h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at room temperature in darkness with the primary antibody solution containing mouse anti-vesicular Glutamate Transporter 1 (vGLUT1, 1:1000, MAB5502, Merck) or rabbit anti-Glutamate Decarboxylase 65-67 (GAD 65-67 ...
-
bioRxiv - Neuroscience 2020Quote: ... The blots were blocked in PBS/ 0,05%Tween20 containing 5% skim milk and then probed with the following primary antibodies over night at 4°C: mouse anti-P53 (1:100, Merck), rabbit anti-H2AX (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... blocked with 10% bovine serum albumin (BSA) 30 min at 37°C and incubated with primary anti-γH2A.X mouse antibodies (Merck Millipore) or rabbit anti-LC3B antibodies (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse LL/2 (LLC1; ATCC no. CRL-1642; obtained in 2015) was grown in BME with Earle′s salts (Merck) with the same supplementation as mentioned above ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Sections containing SN and VTA were incubated with antibodies directed against tyrosine hydroxylase (mouse monoclonal, 1:1000, Merck-Millipore MAB318) and mCherry (rabbit polyclonal ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at room temperature in darkness with the primary antibody solution containing mouse anti-vesicular Glutamate Transporter 1 (vGlut1, 1:1000, MAB5502, Merck) and rabbit anti-Glutamate Decarboxylase 65-67 (GAD 65-67 ...
-
bioRxiv - Cell Biology 2022Quote: ... and SDS-PAGE and immunoblots were performed by standard methods using a mouse monoclonal anti-MYC antibody (clone 4A6, 05-724, Merck).
-
bioRxiv - Bioengineering 2020Quote: ... or mouse monoclonal β-actin antibody (1:1000 dilution; catalog no. catalog no. MAB 1501; Merck Millipore, Burlington, MA, USA) at room temperature for 1 hour ...
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by washing and staining with horseradish peroxidase-conjugated donkey anti-rabbit or anti-mouse IgG secondary antibodies (1:5,000 dilution; Merck Millipore), respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... AB5543), chicken anti-β3 tubulin (1:500, AB9354) and mouse anti-ankyrin G (1:500, MABN466) were purchased from Merck Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000, Merck Millipore ...
-
bioRxiv - Genetics 2021Quote: ... a mouse anti-glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody (#MAB374, used at 1:10,000 for the Western blot analyses, Merck Millipore); a rabbit anti-LC3B polyclonal antibody (#2775 ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following antibodies were used for ChIP analysis: Mouse anti-RNA polymerase II antibody clone CTD4H8 (Merck Millipore, 05-623), Rabbit anti-NF-kB p65 antibody clone D14E12 (Cell Signalling ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were run on SDS-PAGE and the expression of IDO1 was analyzed with a mouse anti-IDO1 antibody (clone 8G-11, Merck). Mouse monoclonal Ab against β-tubulin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... the fixation procedure above with and without subsequent membrane permeabilization was used in infected/uninfected organoids that were then stained with a mouse monoclonal anti-mitochondria antibody Cy3 conjugate (Merck) incubated overnight at 4 °C ...