Labshake search
Citations for Merck :
551 - 600 of 4074 citations for 6 Bromo 3 4 dihydro 2H 1 benzopyran 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and 10% ultra-pure water from Direct-Q 3 UV Water Purification System with LC-Pak Polisher (Merck KGaA) and mobile phase B was 10 mM ammonium acetate at pH 9 in ultra-pure water with 15 μM medronic acid (InfinityLab Deactivator additive ...
-
bioRxiv - Molecular Biology 2022Quote: All samples were centrifuged at 16,000 × g for 30 min and 400 µL supernatant was loaded on a 0.5 mL centrifugal ultrafiltration unit with 3 kDa cut-off membrane (Amicon, Merck) and concentrated down to 20 µL ...
-
bioRxiv - Immunology 2022Quote: ... For intracellular cytokine labeling cells were incubated for 3 h at 37°C in RPMI-1640+10% FBS with PMA (10μg/ml, Merck), Ionomycin (1μg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated in the presence or absence of aphidicolin 2μM for 3 hours together with cytochalasin B (3μg/ml, Merck Millipore) to block cytokinesis prior to fixation for immunofluorescence.
-
bioRxiv - Biochemistry 2022Quote: ... The LE11-27 DNA was dialyzed against the same buffer and concentrated to ~ 2.5 mM (Vivaspin 500, 3 kDa MWCO, Merck). The complex was formed by mixing the protein and the DNA in a 2:1 protein-to-DNA ratio (final concentration of 800 µM and 400 µM ...
-
bioRxiv - Immunology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination using LookOut Mycoplasma qPCR Detection Kit (Merck 200-664-3). None of the cell lines were authenticated but low passage numbers were utilized.
-
bioRxiv - Biochemistry 2023Quote: ... The eluted protein was concentrated and using using Amicon Ultra-15 centrifugal filters (3 kDa cut-off, Merck-Millipore) and then buffer was exchanged to buffer B (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was transferred to an Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore, Catalogue no. UFC500396) and centrifuged at 10,000 g for 20 min at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The methanol-fixed samples were transferred to 3% glutaraldehyde solution (Agar scientific) in 0.1 M sodium phosphate buffer (Merck). Dehydration was performed with ascending ethanol series (30% ...
-
bioRxiv - Cancer Biology 2023Quote: ... Japan) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck, Darmstadt, Germany) coupled with a Q Exactive instrument (PFPP-LC/MS ...
-
bioRxiv - Immunology 2024Quote: ... Cell supernatant was then concentrated by Tangential Flow Filtration with a Pellicon 3 Ultracel 10 kDa membrane (Merck Millipore) and loaded onto a 10 mL CaptureSelect™ C-tagXL affinity column that had been equilibrated in Tris-buffered saline (TBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Cell Biology 2023Quote: ... rinsed in running tap water for 3 min and stained with 0.02% Fast Green for 30 seconds (F7252, Merck), followed by 1% acetic acid for 30 seconds and Safranin’O solution for 45 min (S2255 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... IL-10 and TNF-α were quantified in the FN of NL and at 21dpi aged GFAP-IL6Tg and WT mice (n= 4-6/experimental group) using a Milliplex MAP Mouse High Sensitivity kit (#MHSTCMAG-70K; Merck Millipore), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... were randomly assigned to receive an injection of 0.9% NaCl v/v 5-bromo-2’Deoxyuridine (BrdU) 100 mg/kg (MERCK; New York, USA) three times within the same day ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were first permeabilized in PBS 0.5% Triton X-100 for 2h at room temperature and incubated in 10µg/mL DAPI (Sigma-Aldrich-Merck, D9542) for 30min ...
-
bioRxiv - Biophysics 2020Quote: ... 105 cells were seeded on the upper chamber of 24 well plate cell culture inserts containing 3 µm pores (Cat # 353096, Merck). The inserts were coated with rat-tail collagen I ...
-
bioRxiv - Cell Biology 2020Quote: ... Viruses were collected from the supernatant 24 hours later and cleared by centrifugation at 2000 rpm for 3 minutes followed by filtration with 0.45 µm PVDF syringe filter units (Merck, #SLHV033RS). Cleared supernatants were titrated by plaque assay using BHK-21 cells.
-
bioRxiv - Immunology 2021Quote: ... was mixed 1:1 and incubated at RT for 2-3 min or ECL substrate is added (Immobilon crescendo western HRP substrate, WBLUR0100, Merck). Membranes were then exposed to film and developed or visualised by chemiluminescence using the G:BOX Chemi gel doc Imaging System Instrument (Syngene) ...
-
bioRxiv - Microbiology 2019Quote: A sample (10 mL) was removed from the Gambierdiscus culture and filtered through 3-μm membrane (Merck Millipore, Darmstadt, Germany). One hundred microliters of the filtrate ...
-
bioRxiv - Evolutionary Biology 2020Quote: Larvae were raised as described above until 11 dpf and deeply anesthetized with 160 mg/l of Tricaine (Ethyl 3-aminobenzoate methanesulfonate salt, MS-222, Merck) before dissecting their pectoral fins ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were permeabilized with 0.1 % Triton-X100 in PBS for 20 min at RT and samples were blocked with freshly prepared 3 % bovine serum albumin (BSA, Merck) in PBS for 1 h at RT ...
-
bioRxiv - Molecular Biology 2021Quote: Heat-mediated antigen retrieval was performed for 3 min at 99°C in a 40mM trisodium citrate (Merck, Darmstadt, Germany) solution ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Neuroscience 2021Quote: Viability of SH-SY5Y cells after treatments with or without H-LIPEF was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Neuroscience 2019Quote: ... The HiTrap SP elution fractions containing the Tau proteins were concentrated using a 30 MWCO (for full length tau) or 3 MWCO (for tau fragments) Amicon centrifugal filter unit (Merck) and loaded on a HiLoad 16/600 Superdex 75 pg size exclusion chromatography column (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... Chromatographic separation of AAs was achieved by applying 3 μl of dissolved sample on a SeQuant ZIC-HILIC column (3.5 μm particles, 100 × 2.1 mm) (Merck, Darmstadt, Germany), combined with a Javelin particle filter (Thermo Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Cell Biology 2021Quote: Cells were sonicated at low power for 3 s and loaded onto a commercial microfluidics system (Y04C-02 plates, CellASIC ONIX2 system, Merck). While loading the cells ...
-
bioRxiv - Biochemistry 2020Quote: ... each N-Cdh sample was desalted against PBS using Amicon centrifugal filters with a 3 kDa molecular weight cutoff according to the manufacturer’s protocol (Merck-Millipore). Unprocessed xCGE-LIG N-glycocomics raw data are available upon request.
-
bioRxiv - Bioengineering 2021Quote: ... 99%+, Figure S1(d)), and dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP, 42% solution in methanol) were obtained from Merck–Sigma Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 100 μL aliquots were removed and the reaction was stopped using a 3 KDa nominal molecular weight limit (NMWL) centrifuge filter (Merck Amicon Ultra 0.5mL Centrifugal Filters ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Major peaks were desalted by RP-HPLC using an Ascentis C18 column (3 μm, 4.6mm ID x 15 cm, Sigma-Merck, Germany) using peak-based collection (slope) ...
-
bioRxiv - Systems Biology 2020Quote: ... The resultant pellets were resuspended in 3% acetonitrile + 0.1% trifluoroacetic acid and peptide quantification performed using the Direct Detect system (Merck Millipore). Protein samples were normalized then vacuum concentrated in preparation for mass spectrometry.
-
bioRxiv - Cell Biology 2020Quote: ... Cell medium was replaced with 3 mL medium containing 20 μL of the purified lentivirus and 3μl polybrene transfection reagent (Merck Millipore). Medium was supplemented with 10 µg/mL puromycin for selection of successfully transduced cells two to three days after transduction.
-
bioRxiv - Biochemistry 2022Quote: ... The purified proteins were concentrated to 2 mg/mL using centrifugal filters with either 3 kDa or 30 kDa cut-off (Amicon Ultra-0.5, Merck/Millipore) and the samples were centrifuged at 100,000 g ...
-
bioRxiv - Cell Biology 2022Quote: ... The remaining media was then concentrated down to 500 uL using a falcon tube sized 3 kDa amicon column (UFC900308; Merck) spun at 4000 xg and 4°C for approximately 1 h ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Bioengineering 2022Quote: ... 100 nM of RNA polyhedra samples folded in TE/Mg2+/Na+ buffer were concentrated four times using 3 kDa MWCO Amicon Ultra centrifugal filters (Merck). 5 µl of the concentrated sample was applied on 300 mesh Cu grids coated with lacey carbon (Agar Scientific) ...
-
bioRxiv - Biochemistry 2022Quote: ... Chromatography was performed on a zwitterionic (ZIC) column with phosphocholine phase (ZIC-cHILIC, 2.1 mm i.d. x 150 mm, 3 μm; Merck SeQuant, Sweden) [38] ...
-
bioRxiv - Genetics 2021Quote: ... At day 10 cells were passaged at a 2:3 ratio into 12 well cell culture plates coated with 15 µg/ml human plasma fibronectin (Merck) in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Biophysics 2020Quote: ... The Q column flow-through containing nsp8 or nsp7 was concentrated using a MWCO 3 kDa Amicon Ultra Centrifugal Filter (Merck) and applied to a HiLoad S200 16/600 pg equilibrated in size exclusion buffer (150 mM NaCl ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The five eluted aliquots were then concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK) and desalted with filtered water to remove urea and salts ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... ssDNA was eluted and concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK), as described earlier ...
-
bioRxiv - Biophysics 2022Quote: ... Annealed samples were exchanged to NMR buffer (20 mM potassium phosphate, pH 7.0) using 3 kDa centrifugal filters (Amicon, Merck Inc.) spun at 4000 g and 4 °C to a final volume of 250 µL ...
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Neuroscience 2019Quote: ... The HiTrap SP elution fractions containing the tau proteins were concentrated using a 30 MWCO or 3 MWCO Amicon centrifugal filter unit (Merck) and loaded on a HiLoad 16/600 Superdex 75 pg size exclusion chromatography column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3 μg proteins were separated by SDS-PAGE and electrotransferred onto Immobilon®-P transfer membranes (Merck Millipore, MA, USA), blocked with 5% skim milk in Tris-buffered saline with 5% Tween 20 (TBST) ...