Labshake search
Citations for Merck :
551 - 600 of 1058 citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... before being incubated for 5 secondes in Luminata Classico Western HRP substrate (Merck Millipore, Molsheim, France) and then imaged for chemiluminescence using the ChemiDoc Touch Imaging System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... E15.5 or P7 CGNPs were plated as described above in the presence 5 μM Cyclopamine (Merck), 250 nM Purmorphamine (Stem Cell Technologies) ...
-
bioRxiv - Immunology 2020Quote: ... naïve T cells were freshly isolated and subsequently cultured for 4/5 days in RPMI (Merck), containing 10% Heat Inactivated FCS (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... washed four times with PBS and permeabilized for 5 min with 0,5% Triton X-100 (Merck) in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were treated with 10 μM DAPT and 5 μM Cytarabine (ARA-C) (Merck, Cat#C3350000) for 24 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... Chromatographic separation was performed on a Sequant ZIC-pHILIC column (5 μm, 2.1 × 150 mm; Merck) maintained at 45°C ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Microbiology 2022Quote: ... 50 and 70% for 5 min and 95% and 100% twice for 10 min (Merck Millipore). The coverslips were then critical-point-dried using an EM DPC 300 critical point drier (Leica ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µm) coupled with a SeQuant® ZIC®-pHILIC Guard (20 mm × 2.1 mm) (Merck) was used for analyte separation ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 % Natural Goat Serum (Goat serum from controlled donor herd, G6767-100ML, Sigma Aldrich, Merck, Germany) and primary antibodies (see Table 3 ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were spotted on a 5 x 10 cm TLC silica gel 60 F254 (Merck) and developed in petroleum ether:diethyl ether (9:1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... reduced with 5 mM TCEP for 30 min and alkylated with 10 mM iodoacetamide (Merck, I1149) for 30 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 50 μL magnetic beads were incubated with 5 μg of Ago-1 antibody (Merck, Millipore, Germany) or IgG antibody (Merck ...
-
bioRxiv - Cell Biology 2023Quote: Oocytes were cultured in G-IVF PLUS (Vitrolife, #10136) under mineral oil (Merck, # 8042-47-5) at 37°C in 5% O2 ...
-
bioRxiv - Biophysics 2023Quote: ... adult male Wistar rats aged ∼ 5 weeks were given an intraperitoneal injection of crotaline (Merck, NJ) to induce pulmonary arterial hypertension ...
-
bioRxiv - Cell Biology 2022Quote: ... a SeQuant ZIC-pHILIC (100 mm, 2.1 mm I.D. and 5 μm particle size, Merck, Germany) column was used ...
-
bioRxiv - Cancer Biology 2022Quote: ... For final and irreversible sample dehydration a graded serie (25%, 50%, 75% and 100%, 5 min each) of 1,1,1,3,3,3-hexamethyldizilazane (HDMS, Merck, Millipore) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... Parasitemia was maintained below 5% and determined via Hemacolor staining of blood smears (Sigma-Aldrich, Merck) using a Nikon Eclipse E100 microscope (Nikon Corporation ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Cell Biology 2023Quote: ... Preparations were thereafter fixed with 100% methanol for 15 s and stained with 5% Giemsa (Merck) for 15 minutes ...
-
bioRxiv - Immunology 2023Quote: Resuspended HLA-I-eluted samples were centrifuged through 5 kDa cutoff filters (Merck Millipore #UFC3LCCNB-HMT) and vacuum-dried ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... For removal of chorion embryos were incubated for 5 mins with 1 mg/ml Pronase (Merck) then washed with culture medium and flash-frozen in liquid nitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... neurons were permeabilized and blocked with PBS containing 0.1% Triton X (#9005-64-5, Merck, Germany), 5% ...
-
bioRxiv - Biochemistry 2024Quote: ... the spacer region between them and flanking regions of 5 bp were ordered from Merck (Germany). The 5’ end of sense strand of each oligonucleotide was labeled with Cyanine 5 dye (Cy5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... animals were transferred to 10 cm NGM agar plates containing 5-FU (10 µM) (Merck, #F6627) to prevent progeny production ...
-
bioRxiv - Molecular Biology 2024Quote: ... animals were transferred to 10 cm NGM agar plates containing 5-FU (10 µM) (Merck, #F6627) to prevent progeny production ...
-
bioRxiv - Genetics 2024Quote: ... Membranes were blocked for a minimum of 30 min in 5% Skim Milk Powder (Merck, #70166) in PBS + 0.1% Tween-20 (PBS-T ...
-
bioRxiv - Immunology 2024Quote: ... slides were rinsed in double-distilled water and counterstained with Hoechst dye (5 μg/mL; Merck). Stained slides were subsequently imaged using an LSM700 confocal microscope (Zeiss).
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Microbiology 2024Quote: ... the bacterial isolates were cultured overnight in 5 mL of sterile Muller-Hinton broth (Merck, Germany) at 37 °C ...
-
bioRxiv - Genomics 2024Quote: ... Coverslips were re-calibrated in PBST (PBS with 0,2% Tween 20 Merck, Cat 9005-64-5) for 5 minutes and 50ul of primary antibody (rabbit anti-BRD4 ...
-
bioRxiv - Bioengineering 2024Quote: ... and 5 mg ml-1 fibrinogen from bovine plasma type I-S (Merck KGaA, Darmstadt, Germany); then ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by 5 min in a 1:1 mixture of propylene oxide (Fluka, Merck, Darmstadt, Germany) and SPURR (Low Viscosity Spurr Kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... Females were stimulated with 5 IU of pregnant mare serum gonadotropin (PMSG; Folligon; Merck Animal Health) per mouse 46 hours prior to oocyte isolation ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 mM MgCl2) before addition of Laemmli buffer with 0.25 U/µL benzonase (final concentration, Merck Millipore) for 10 min followed by 5 min denaturation at 95°C.
-
bioRxiv - Immunology 2021Quote: ... The plates were finally washed 5 times with HSWB before adding 100 µL of TMB (Merck, Germany) to each well ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Microbiology 2020Quote: ... pH 7.2) and purified by filtration through 5 μm pore polycarbonate membranes (Merck Millipore Co. Cork, Ireland).
-
bioRxiv - Cancer Biology 2022Quote: PEGylated-poly T coated coverslips were assembled as described and further passivated with 5% BSA (Merck, A7906) for 30 minutes followed by wash with IMB ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were washed three times with PBS and blocked with 5% normal donkey serum (NDS) (Merck-Millipore), 0.1% Triton X-100 in PBS for 1 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... supplemented with 2.5 µM IWP4 (Stemgent, Cambridge, MA, USA) and 5 µM XAV939 (Merck, Kenilworth, NJ, USA). The culture medium was refreshed with RPMI□+□B27+insulin medium every other day ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was cleared via centrifugation and loaded on two 5 mL HiTrap Heparin HP (Cytiva, Merck) columns (connected in series ...
-
bioRxiv - Neuroscience 2022Quote: Conditioned media from astrocytes were collected at 5 DIV and filtrated with Millex-GP filter (SLGPR33RS, Merck). ACM was concentrated with Amicon Ultra 10kDa (UFC501008 ...
-
bioRxiv - Cell Biology 2022Quote: ... at a final concentration of 5 μg/ml in M2 medium or Latrunculin B (428020-1MG, Merck) at a final concentration of 5 μM in M2 medium (to disrupt F-actin) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Membranes were blocked with 5% non-fat milk in PBS with 0.05% Tween-20 (Merck; blocking buffer) and incubated with primary antibodies (Supplemental Table 2 ...
-
bioRxiv - Immunology 2020Quote: ... Lysates were further cleared by sterile filtration employing a 5 µm filter unit (Merck Millipore, Darmstadt, Germany). The first column contained 1 mg of W6/32 antibody coupled to sepharose ...
-
bioRxiv - Developmental Biology 2021Quote: ... plus 5 % sheep serum in MAB and incubated with anti-DIG conjugated to Peroxidase (1/50; Merck) in 1 % blocking reagent diluted in MAB for 3 days at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Immunology 2021Quote: ... pH 5 (0.1 M citric acid monohydrate from Sigma and 0.2 M disodium phosphate dihydrate from Merck)) was added to the plate and incubated for 30 minutes in the dark ...