Labshake search
Citations for Merck :
551 - 600 of 5749 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 1/10 volume of 1% IGEPAL CA630 (Sigma, Merck) was added to the samples and incubated for additional 3 minutes at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 µM StemReginin 1 (SR1, Merck Millipore, 182706) for the indicated time points.
-
bioRxiv - Bioengineering 2024Quote: ... bone morphogenetic protein antagonist (DMH-1, Merck, 1 mM), and transforming growth factor β antagonist (A 83-01 ...
-
bioRxiv - Plant Biology 2023Quote: ... Acid digestion was performed by adding 9 mL of 69% nitric acid (HNO3) (Suprapur, Merck) and 1 mL of 30% hydrogen peroxide (H2O2 ...
-
bioRxiv - Neuroscience 2024Quote: ... The tissue sections from the in vivo experiment were incubated with a rabbit primary antibody for GluR2/3 (Merck Millipore; AB1506; 1:200) overnight and then with a secondary goat anti-rabbit IgG (Cell Signaling Technology ...
-
bioRxiv - Plant Biology 2023Quote: ... The sections were then incubated for 1 h with 700 µL of a 10% (v/v) DMSO/3% (v/v) IGEPAL® CA-630 (Merck, Darmstadt, Germany) in MTSB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The following day the membrane was washed with T-PBS (0.1% tween) (15 min x 3 times) and appropriate secondary antibody: (i) anti-rabbit antibody conjugated with peroxidase enzyme (Merck Sigma, Burlington, MA) was dissolved in 5% BSA in T-PBS (0.1% tween ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...
-
bioRxiv - Immunology 2021Quote: ... blocked in 5% BSA for 30 min and incubated ON with mouse anti-GAD67 monoclonal antibody (1:6000, MAB5406, Merck Millipore) or 1 h with rabbit polyclonal anti-GAPDH antibody (1:3000 ...
-
bioRxiv - Genomics 2023Quote: ... 20 µL of frozen cells were lysed by a 3-min incubation at 100°C in 5% boiling SDS with 2x final concentration of Protease Inhibitor Cocktail Set 1 (Merck Chemicals). After centrifugation (5 min 15000g) ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies (FUS 1:100 Santa Cruz Biotech sc-47711; ISL1 1:500 Abcam ab109517; OLIG2 1:100 R&D Systems AF2418; NFM 1:1000 Merck MAB1621) were added in 1% BSA and incubated at 4degC overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then incubated for two nights at 4°C with primary antibodies against glial fibrillary acidic protein (GFAP; 1:5000; MAB360; Merck Millipore, USA), ionized calcium binding adaptor molecule 1 (Iba1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then incubated for two nights at 4°C with primary antibodies against glial fibrillary acidic protein (GFAP; 1:5000; MAB360; Merck Millipore, USA), ionized calcium binding adaptor molecule 1 (Iba1 ...
-
bioRxiv - Neuroscience 2022Quote: ... for 5 min each at RT and incubated with secondary antibodies in TPBS-TS-1% for 4h at 4°C (Alexa Fluor 546 anti-Mouse (Merck, A-11018), Alexa Fluor 488 anti-goat (Abcam ...
-
bioRxiv - Pathology 2022Quote: ... The sections were incubated overnight at 4°C in a pre-incubation solution containing mouse monoclonal em48 (Merck Millipore; MAB5374, 1:400) and rabbit polyclonal Laminin (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.1% (20mM Tris and 500mM NaCl pH 7.5) and incubated overnight at 4°C with the primary antibody: anti-GluN1 (1:1000; Merck KGaA, Darmstadt, Germany) and anti-GluN2A monoclonal antibody (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were permeabilized for 10 minutes in 0.5% Triton X in PBS and incubated for 48 hours at 4°C in rabbit anti-NG2 (AB5320, Merck Millipore; 1:500) and rat anti-MBP (MCA409 ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µl of each dilution were mixed with 10 µl of 0.4 mg ml-1 4-methyl-umbelliferyl-β-D- galactopyranoside (MUG) substrate (Merck, Darmstadt, Germany) that was prepared in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Biochemistry 2023Quote: ... The 100-fold dilution of culture was made up to 10-4 dilutions and spotted on TYE plates (Hi-Media Laboratories Ltd., India) having 1% glucose (Merck & Co., USA) and ampicillin (Gold Biotechnology ...
-
bioRxiv - Molecular Biology 2024Quote: ... diluted 1:2000 and incubated overnight at 4°C followed by an secondary anti-rabbit HRP conjugated antibody (12-348, Merck Millipore, Germany) diluted 1:5000 in PBST and incubated for 1 h at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tubulin beta (1:8,000; clone KMX-1 from Merck Millipore), dMi-2 (1:8,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-TUJ-1 antibodies (1:200; Merck-Millipore, MAB380) for 48 h ...
-
bioRxiv - Microbiology 2021Quote: ... GLP-1 (GLP-1 total ELISA kit, Merck, Darmstadt, Germany) and biochemical parameters including ALT ...
-
bioRxiv - Cell Biology 2021Quote: ... Armenian hamster PECAM-1 (MAB1398Z, Merck Millipore, IHC: 1/500); goat VE-cadherin (sc-6458 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 mg ml−1 collagenase IV (Merck Millipore, C4-22) and 70 U ml−1 DNase (Invitrogen ...
-
bioRxiv - Systems Biology 2023Quote: ... after adding 1 mL of chloroform:methanol 2:1 (v:v) (Merck), the sample was vortexed at 1200 rpm for 1 h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μL RNase A (10 U µL−1) (Merck) per mL of stock and incubated at 37°C for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% (vol/vol) Protease Inhibitor Cocktail Set 1 (Merck Millipore) and 1x PhosSTOP (Roche) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% (vol/vol) Protease Inhibitor Cocktail Set 1 (Merck Millipore) and 1x PhosSTOP (Roche) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 mL of 40 mg mL− 1 EDC (Merck 341006) and 1 mL of 65 mg mL−1 sulfo-NHS (Merck 56485 ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Genetics 2024Quote: ... The harvested medium was then centrifuged at 1,300 rpm at 4 °C for 5 min to remove cells and then filtered by 0.45 μm filter (Merck) and the virus was collected and stored at -80 °C.
-
bioRxiv - Biochemistry 2024Quote: ... Ultrapure nitric acid was produced in-house from trace analysis grade nitric acid (Merck, Darmstadt, Germany) using a SubPur quartz sub-boiling distillation system (Milestone ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% BSA (Merck), 10% FBS (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... + 1% Paraformaldehyde (Merck) in 0.1 M Phosphate buffer (PB ...
-
bioRxiv - Immunology 2023Quote: ... + 1 % Paraformaldehyde (Merck) in PIPES pH 7.4 and stored at 4°C until further processed ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% BSA (Merck) at RT for 1 h ...