Labshake search
Citations for Merck :
551 - 600 of 4630 citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... # T7408) using an ultrafiltration cartridge (Amicon Ultra 0.5 mL 3 K; Merck, Readington, NJ, USA; Cat. # UFC500324). The total protein levels in the samples were assayed using the Pierce™ BCA Protein Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cell extracts were concentrated using Amicon Ultra-15 3 kDa cutoff (Merck Millipore, Burlington, MA, USA). The obtained cell extract was flash-frozen in liquid nitrogen and preserved at −80 °C until further use.
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... glutamine-free RPMI was supplemented with 2mM [1,5-15N]-L-Glutamine or [3-13C]-L-Glutamine (Merck).
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Cell Biology 2024Quote: ... The eluate from each column was pooled and concentrated in a 3 KD amicon column (Merck, UFC5003) to just under 100 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were later exposed to a 3% bovine serum albumin (BSA, A3912, Merck Life Science, Milan, Italy) solution in DPBS containing 0,1% Triton at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AQR-GFP plasmid (RG220742) was used for the mutagenesis with KOD polymerase (Merck/Millipore, 71086□3), used according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Microtubule-Associated Protein 2 (MAP-2) (Merck Millipore Burlington ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% glucose + 2% D/L-lactate (Merck), or 2% D/L-lactate alone [31].
-
bioRxiv - Microbiology 2023Quote: ... dimethyl sulfoxide (DMSO) (Merck), dimethylacetamide (DMAc ...
-
bioRxiv - Cancer Biology 2022Quote: ... special AT-rich sequence binding protein 2 (SATB2; clone EP281, Merck, USA; 1:200), and programmed cell death ligand 1 (PD-L1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg purified recombinant LARK protein or 1 μg BG4 (MABE917, Merck, Darmstadt, Germany) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... and NG2 (neuron-glial antigen 2, AB5320, Merck Millipore, Burlington, MA, USA, 1:400) were used.
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1 mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Developmental Biology 2024Quote: ... 50 μg ml−1 L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Merck A8960), 20 ng ml−1 heregulin beta-1 (Thermo Fisher 100-03-50UG) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and tamoxifen (1uM 4-hydroxy-tamoxifen, Merck, Australia) treatments ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified ShTnsC was concentrated to 1-2 mg mL−1 using 30,000 kDa molecular weight cut-off centrifugal filters (Merck Millipore) and flash-frozen in liquid nitrogen.
-
bioRxiv - Immunology 2022Quote: ... and spleen were harvested and homogenated in PBS for CFU counting or in isotonic buffer (Tris HCl 50 nM, EDTA 2 mM, PMSF 1 mM [Roche Diagnostics GmbH], Triton X-100 1% [Merck Life Science] ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified ShTnsC was concentrated to 1-2 mg mL−1 using 30,000 molecular weight cut-off centrifugal filters (Merck Millipore) and flash-frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit mAb Phospho-MAPK (Erk 1/2 Thr202/Tyr204) (D13.14.4E) (1:1,000; #4370; Cell Signaling Technology, mouse mAb GAPDH (1;5000, G8795, MERCK/Sigma-Aldrich).
-
bioRxiv - Microbiology 2020Quote: ... purified ParB was concentrated by centrifugation in an Amicon Ultra-15 3-kDa cut-off spin filters (Merck) before being loaded into a Superdex 75 gel filtration column (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mo and PN were then washed in DMEM and placed in 3 μm Boyden chambers (Merck Millipore, France), at the concentration of 0.5 x 106 cells/chamber in 200 µl DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... purified ParBΔCTD was concentrated by centrifugation in an Amicon Ultra-15 3-kDa cut-off spin filters (Merck) before being loaded into a Superdex-200 gel filtration column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... and HPLC separation with a ZIC®-cHILIC column (3 µm, 100 Å, 150 mm × 2.1 mm, Merck) and a similar guard column (20 mm × 2.1 mm ...
-
bioRxiv - Physiology 2020Quote: ... at 4°C for 60 min using an Amicon Ultra-4 3 kDa centrifugal filter device (Merck Millipore). The 50 μL retentate was the final volume of concentrated EVs ...
-
bioRxiv - Systems Biology 2020Quote: Wnt signal inhibitor (CK) stock (2.4–3 mM): CKI-7 dihydrochloride (#C0742-5MG, Merck & Co., Inc., NJ, USA) diluted in distilled water (Otsuka Pharmaceutical Factory ...
-
bioRxiv - Cell Biology 2022Quote: ... The corresponding GST fusion protein was added to a final concentration of 15 µg/ml in incubation buffer (10 mM Tris pH 8.0, 150 mM NaCl, 0.1 % Tween-20, 3 % BSA (fatty acid free, Merck)) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... F2 FLAG-tagged TBP::NveRLR::mCherry and wild-type zygotes were treated with 3% L-Cysteine (Merck Millipore), washed and snap frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 µL of sample was carefully spotted onto pre-washed PEI-cellulose TLC plates (Merck Millipore, #105725). The TLC plate was eluted in developing buffer containing 10 mM NH4Cl and 5% acetic acid for 100-140 min ...
-
bioRxiv - Neuroscience 2020Quote: ... the eluate was up-concentrated to 3 ml using an Amicon Ultra 3000 MW centrifugal filter unit (Merck). Concentration assessment with a NanoDrop (∊ = 2980 ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfections of DNA plasmids were carried out with the NanoJuice Transfection Kit (71900-3, Merck, Kenilworth, NJ, USA) or the Avalanche-Everyday Transfection Reagent (EZT-EVDY-1 ...
-
bioRxiv - Microbiology 2023Quote: Supernatants showing biological activity were concentrated using Amicon Ultra-0.5 centrifugal filters (3 kDa) (Merck KGaA, Darmstadt, Germany) as follows ...
-
bioRxiv - Immunology 2023Quote: Peripheral blood mononuclear cells were thawed in the presence of benzonase (Merck 70746-3, used at 1µl/ml), cells were counted and up to 3 x 106 cells were processed for mass cytometry ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Genetics 2023Quote: ... Supernatant was then transferred to an Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore, no. UFC500396) and centrifuged for 45 min at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was concentrated to ∼500 μL using Amicon Ultra-15 Centrifugal Filter Units (Merck Millipore MWCO 3 kDa). The concentration of proteins was determined using JASCO V730 UV-vis spectrophotometer at 280 nm ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Cell Biology 2022Quote: ... expanding cells were transferred to erythroid differentiation medium (Iscove’s medium with stable glutamine [Merck] containing 3% (v/v) AB serum [Merck] ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Biochemistry 2023Quote: ... and centrifuging in 10 K (3 K for dA) ultra-centrifugal filters Amicon® (Merck KGaA, Darmstadt, Germany). This process was repeated five times to dialyze the ligand ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pellets were resuspended in 50µl NMR buffer (100 mM sodium phosphate, 500µM Sodium 3-(trimethylsilyl)propionate (TMSP; Merck), 10% D2O ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then washed through three 70μl drops of PBST before being transferred to 50μl drops of blocking 3% BSA (Merck) in PBST for 30 minutes ...
-
bioRxiv - Immunology 2022Quote: ... washed again twice in TBS and then blocked with 3% BSA (Carl Roth) and 0.1% Tween-20 (Merck) in TBS at RT for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was applied to 3 kDa MWCO filters (Amicon Ultra-0.5 Centrifugal Filter; Merck Millipore, Darmstadt, Germany), and centrifuged at 14,000 × g for 45 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: Treatments for the LC3 assay included 3 hours with mTOR inhibitor Torin1 (Merck-Millipore, final concentration 250 nM), Bafilomycin A1 (Sigma ...
-
bioRxiv - Physiology 2024Quote: ... washed in tap water for 3 min and stained with 0.02% Fast Green for 30 seconds (F7252, Merck), followed by 1% acetic acid for 30 seconds and Safranin’O solution for 45 min (S2255 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The dialyzed solution was concentrated using an Amicon Ultra-0.5 Centrifugal Filter Unit (3 kDa cutoff) (Merck Millipore). The purity of the purified protein was confirmed by SDS‒PAGE (49) ...