Labshake search
Citations for Merck :
551 - 600 of 3376 citations for 2' 4' Dichloro 3 2 5 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: Titration assays using the high-affinity inhibitor MLi-2 (Merck, USA) were performed to determine the active protein concentrations of the LRRK2RCKW variants ...
-
bioRxiv - Neuroscience 2020Quote: ... chicken anti-microtubule-associated protein 2 (MAP2; 1:2000; Chemicon/Merck), and guinea pig anti-vesicular glutamate transporter 1 (VGLUT1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The suspension was filtered through 2 layers of Miracloth (Merck Millipore) into 50 ml Falcon tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... CtXPB was expressed in Rosetta™ 2 (DE3) cells (Merck Millipore), ctXPD was expressed in ArcticExpress (DE3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and Benzonase Nuclease (100 U/ml; Merck Millipore). Lysates were cleared by centrifugation at 14,000 rpm for 15 minutes ...
-
bioRxiv - Genomics 2020Quote: ... fish were anesthetized in 2-phenoxyethanol (300 ppm; Merck; 807291; USA). Recovery was performed in a separate tank with provision of air before fish returned to their holding tank ...
-
bioRxiv - Immunology 2020Quote: ... and 0,1 % (v/v) 2-mercaptoethanol (ß-ME, Merck, Darmstadt, Germany). B cell cultures were maintained by 37°C containing 5% CO2.
-
bioRxiv - Immunology 2021Quote: ... TILs were incubated with mouse IL-2 (mIL2-Ref: 11271164001-MERCK) 100U/ml in DMEM medium containing 10% FBS and 1% Penicillin/Streptomycin at 37°C for 2 days ...
-
bioRxiv - Cell Biology 2023Quote: MUC17(7TR) Caco-2 cells grown on Transwell filters (CLS3496, Merck) for 7 ...
-
bioRxiv - Immunology 2023Quote: ... and human rIL-2 (30 U/ml) (Roche/Merck, Darmstadt, Germany) to the culture ...
-
bioRxiv - Microbiology 2023Quote: N,N,N’,N’-tetrakis-(2-pyridylmethyl)ethylenediamine (TPEN) (Merck, 616394), made up in DMSO and used at 5 µM ...
-
bioRxiv - Biochemistry 2023Quote: ... the cells were discarded and N-ethyl-maleimide (Merck, 2 mM) and Pefabloc (Roth ...
-
bioRxiv - Molecular Biology 2022Quote: ... concentrated to 2 ml volume in Amicon Ultra-15 concentrators (Merck), and injected on a HiLoad 16/600 Superdex 75 pg (Cytiva ...
-
bioRxiv - Plant Biology 2022Quote: ... 2% Triton X-100) supplemented with 1X plant protease inhibitor (Merck). Cellular debris was removed by several centrifugation steps at 8,000 x g for 10 min at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... U-2 OS cells were maintained in McCoy’s 5A media (Merck) supplemented 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: ... 2% glucose and a multivitamin solution (Polybion SF Complete, Merck Ltd). 10-day old females were blood-fed using the Hemotek membrane feeding system ...
-
bioRxiv - Bioengineering 2023Quote: ... R was measured using Millicell ERS-2 Volt/Ohmmeter (Merck, MERS00002). All procedures were performed on a 38 °C hotplate ...
-
bioRxiv - Biophysics 2023Quote: ... using Pellicon 2 cassette with Biomax 300 kDa Membrane (Merck, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM MgCl2 and Benzonase Nuclease (100 U/ml; Merck Millipore). Insoluble material was pelleted by centrifugation (14,000 rpm ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µM 2,4-dichlorophenoxyacetic acid (Sigma-Aldrich/Merck KGaA, Darmstadt, Germany), 1 μM 6-benzyladenine (Duchefa Biochemie ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was mixed with 2 liters of DEAE-sepharose (Merck) pre-equilibrated with Buffer A+ at 6.9 ...
-
bioRxiv - Neuroscience 2024Quote: ... combined with rabbit anti- MAP-2 (Merck Millipore, #AB5622, 1:800), followed by goat anti-mouse Dylight405 (Jackson ImmunoResearch ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µL Benzonase® nuclease HC (250 U/µL, Merck Millipore) was added and incubated for 30 min (37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... for 2 hours and immunolabelled with anti-collagen VI antibody (Merck Millipore ...
-
bioRxiv - Molecular Biology 2024Quote: ... 213 µg/ml L-ascorbic acid 2-phosphate (ref. A8960, Merck) and 0.5 µg/ml BSA fraction V (ref ...
-
bioRxiv - Biochemistry 2024Quote: ... ZM241385 and 2,2’-azobis(2-amidinopropane) dihydrochloride were purchased from Merck.
-
bioRxiv - Microbiology 2024Quote: ... Two millilitres of 2% osmium tetroxide (ReagentPlus®, 99.8%, Merck, Germany) in distilled water were added to the samples immediately after removal of the buffer and incubated for an additional 30 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were incubated in DAPI (2 µg/ml, 10236276001, Roche Merck) in PBS (10 min) ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 50 μM 2-Phospho-L-ascorbic acid (Merck, 49752). Frozen stocks were prepared at passage 4 and used for all subsequent experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 µM Trolox ([±]-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Merck), 100 µM nocodazole and 1 nM NAP (a gift from Illana Gozes ...
-
bioRxiv - Microbiology 2024Quote: ... The chemical reagents puromycin (58-58-2) was purchased from Merck Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Neuroscience 2022Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Microbiology 2024Quote: ... polyethylene glycol was added to a final concentration of 5% (Cat # 25322-68-3, Merck), and a LFA strip (Cat # 3822-9000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Bioengineering 2021Quote: ... and 2 mL of Naphthol-AS-MX ALP solution (855, Merck KGaA).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktail 2 (1:1000) (Merck Life Sciences U.K. Ltd). Cell debris was removed from lysates via centrifugation (275 × g ...
-
bioRxiv - Molecular Biology 2021Quote: ... grids were colored with aqueous 2% (w/v) uranyl acetate (Merck, France) and then dried with ashless filter paper (VWR ...
-
bioRxiv - Biochemistry 2020Quote: Escherichia coli strain BL21(DE3) Rosetta-2 pLysS (Novagen Merck, Darmstadt Germany) was transformed with pET28a-His6-CrTRXz and grown in 1 L of 2YT medium supplemented with kanamycin (50 µg.mL-1 ...
-
bioRxiv - Immunology 2021Quote: ... 2 was further separated on RP-C18 F254s preparative TLC plates (Merck) using a methanol-acetonitrile (1:1 ...
-
bioRxiv - Cell Biology 2020Quote: ... CDK1/2 inhibitor III (called ‘Cdk1/2i’ in this study, Merck 217714), CHIR-99041 (called ‘GSK3i1’ in this study ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 % (v/v) 2-mercaptoethanol) and 25 U/mL Benzonase (Merck #70746).
-
bioRxiv - Neuroscience 2021Quote: ... 350 µl of a 1:100 dilution of 2-Mercaptoethanol (Merck, 8057400250), 250 µl insulin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-oligodendrocyte transcription factor 2 (Olig2) (Merck-Millipore, 1:200), rabbit polyclonal anti-ionized calcium-binding adapter 1 (Iba-1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used were: rabbit polyclonal to Olig-2 (Merck Millipore, #AB9610) (dilution 1:500) ...
-
bioRxiv - Pathology 2021Quote: ... Mouse anti-E2F4 monoclonal antibody (mAb) clone LLF4-2 (MABE160; Merck Millipore) used at 1/400 for PLA ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.1 mM Na3VO4,0.2 μM microcystin-LR and 10 mM 2-chloroacetamide (Merck)) as described previously (15).