Labshake search
Citations for Merck :
501 - 550 of 1314 citations for Hexadecanoic acid 3 trimethylsilyl oxy methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.55 mM L-glutamic acid (Merck/Sigma-Aldrich, CAS number : 56-86-0), 0.615 mM L-glutamine (Merck/Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... in 1 % acetic acid and counterstaining with 0.04 % Certistain Fast Green (Merck, Germany) in 0.2 % acetic acid.
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Microbiology 2024Quote: ... The chromatic mutants were mixed in different ratios (1:1, 1:3, 3:1) and the mixtures were fixed using 4% paraformaldehyde (Sigma−Aldrich/Merck, Germany) for 4 h at 4°C.
-
bioRxiv - Neuroscience 2024Quote: ... The medium was then collected and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243). Five distinct preparations of ACS <3kDa were prepared from five astrocytes cultures and were then sent to the Protein Analysis Facility of the University of Lausanne for Mass Spectrometry analysis.
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein solution was centrifuged at 16,000 g for 30 minutes with a 3 kD cut-off filter (Amicon Ultra Centrifugal Filter, 3 kDa MWCO, Merck Millipore) to remove previous buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Neuroscience 2021Quote: ... and Pellet Paint Co-precipitant (Merck Millipore #69049-3). Genomic DNA traces were removed with DNA-free DNase Treatment and Removal Reagents (FisherScientific #AM1906 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Biochemistry 2020Quote: ... using 3 kDa MWCO Amicon centrifugal filters (Merck Millipore). For protein denaturation ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... the anti-S tag antibody (Merck, Cat# 71549-3) was added directly to the medium of each well resulting in a final dilution of 1:500 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated with Benzonase Nuclease (Merck Millipore, US170664-3) for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 3-HA were purchased from Merck (Sigma-Aldrich). For L-kynurenine and kynurenic acid ...
-
bioRxiv - Genomics 2022Quote: ... and subsequently blocked in 3% BSA (A8022, Sigma/Merck) in 1x PBS-Tween (137 mM NaCl ...
-
bioRxiv - Plant Biology 2023Quote: ... using a 3 kDa MWCO Amicon centrifugal concentrator (Merck) and the N-terminal His6-tag cleaved with Human Rhinovirus 3C protease at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Microbiology 2022Quote: ... solvent B = acetonitrile with 0.1% formic acid (purity: MS-grade; Merck KGaA, Darmstadt, Germany), t (time)=0 min ...
-
bioRxiv - Biophysics 2021Quote: ... Boric acid (99.5%-100.5%) and sodium hydroxide (≥ 99.0 %) was acquired from Merck (Darmstadt, Germany). Acetic acid was obtained from VWR Chemicals (Leuven ...
-
bioRxiv - Systems Biology 2020Quote: ... At first cells were resuspended in trifluoroacetic acid (TFA) (Uvasol® for spectroscopy, Merck) (sample/TFA 1:4 (v/v) ...
-
bioRxiv - Neuroscience 2020Quote: ... the cerebellar slices were treated directly with glutamate (L-Glutamic acid, Sigma-Aldrich, Merck) twice every 24hours at a concentration of 75μM and 100μM ...
-
bioRxiv - Biochemistry 2021Quote: ... with a continuous flow of 0.1% formic acid in water (UPLC grade, Merck, GE) at 100 μl/min ...
-
bioRxiv - Neuroscience 2021Quote: ... 100 µM L-ascorbic acid and penicillin/streptomycin (all from Merck, Missouri, United States). The culture medium was changed every 2–3 days ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting peptides were extracted in 70% ethanol plus 5% formic acid (Merck-Millipore) twice for 20 min with permanent shaking ...
-
bioRxiv - Immunology 2022Quote: ... HLA-peptide complexes were eluted by repeated addition of 0.2% TFA (trifluoroacetic acid, Merck). Eluted HLA ligands were purified by ultrafiltration using centrifugal filter units (Millipore) ...
-
bioRxiv - Neuroscience 2020Quote: ... at 65°C and in MAB solution (maleic acid buffer; Sigma-Aldrich/Merck, Germany) at room temperature ...
-
bioRxiv - Plant Biology 2021Quote: 2,5-Dihydroxybenzoic acid (2,5-DHB) and ultrapure water were purchased from Merck (Darmstadt, Germany). Indium-thin-oxide (ITO ...
-
bioRxiv - Molecular Biology 2020Quote: ... Afterwards 300 μl of acid washed glass beads (425-600 μM from Sigma/Merck) were added to the cell suspension and kept in ice for 5 min then tubes were vortexed three times with 1 min incubation on ice between each round ...
-
bioRxiv - Biophysics 2021Quote: Fmoc (9-fluorenylmethyloxycarbonyl)-amino acids were obtained from Novabiochem (Merck Biosciences, La Jolla, CA). Rink amide MBHA resin (0.65 mmol/g ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Tryptic peptides were acidified to a final concentration of 1% formic acid (FA) (Merck), cleaned up using SepPak cartridges (Waters) ...
-
bioRxiv - Biochemistry 2022Quote: ... a control solution with identical pH was prepared with hydrochloric acid (1.09057, Merck KGaA). In addition to the pH ...
-
bioRxiv - Bioengineering 2022Quote: ... and MEM non-essential amino acid solution (100x) were purchased from Merck (Darmstadt, Germany). L-glutamine (200 mM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilizing the beads on the magnetic rack ...
-
bioRxiv - Neuroscience 2023Quote: ... The SDC was precipitated from the combined samples using 2% formic acid (FA, Merck).
-
bioRxiv - Biochemistry 2024Quote: ... formic acid (FA) and SeQuant ZIC-HILIC column were purchased from Merck (Darmstadt, Germany). Acetic acid (AA) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The IgG was eluted with 150 µL 0.1 M formic acid (Merck KGaA, Darmstadt) directly into a PCR plate containing 15 µL 1 M ammonium bicarbonate (Acros Organics ...