Labshake search
Citations for Merck :
501 - 550 of 5339 citations for Ethyl 2 pyrrolidin 2 yl 2 3 dihydro 1 3 thiazole 4 carboxylate hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... we added 20mM 2- bromoethanosulfonate (Merck Life Science, Amsterdam, NL) to two of the biological replicates and 50 μg mL-1 puromycin dihydrochloride (Merck Life Science ...
-
bioRxiv - Molecular Biology 2023Quote: ... and ESGRO 2 inhibitors (GSK3i and MEKi) and LIF (Merck). Vitamin C (L-ascorbic acid 2-phosphate ...
-
bioRxiv - Neuroscience 2023Quote: ... in PBS and blocked in 2% normal goat serum (Merck) in permeabilization solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 250 μM IdU (5-Iodo-2’-deoxyuridine, Merck, I7125) as described in the text ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by blocking with 2% BSA solution (Merck Life science) in PBS ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.1% 2-(N-morpholino)ethanesulfonic acid (Merck Millipore, Burlington, MA), and 0.8% agar (BD Biosciences ...
-
bioRxiv - Genetics 2023Quote: ... and CldU 100 μM (5-chloro-2’-deoxyuridine, C6891, MERCK). Cells were embedded in agarose block and DNA was prepared and combed on silanized coverslips ...
-
Highly amine-reactive graphene-oxide EM grids for biochemical surface modification in aqueous bufferbioRxiv - Molecular Biology 2023Quote: ... as a 2 mg/mL dispersion in water (Merck #763705); two bottles obtained from different lots ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 µg of anti-c-myc (4A6; Merck Millipore). For immunoprecipitation of PER2::Luc constructs rabbit anti-firefly luciferase IgG (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... stained with propidium iodide (2 µg/ml; Sigma-Aldrich/Merck) to label dead cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/mL fibroblast growth factor 2 (bFGF, Merck/Sigma), 20 ng/mL epidermal growth factor (EGF ...
-
bioRxiv - Bioengineering 2023Quote: ... the fluorescent latex beads (2 µm, fluorescent red; Merck, Germany) were diluted by 1000 times and added in the MXene electrode to assist in finding the focal plane when applying photo stimulation ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were counterstained with 4,6-diamidino-2-phenylindol (DAPI, Merck) and mounted onto microscope slides with Mowiol 4-88 solution ...
-
bioRxiv - Physiology 2024Quote: ... A volume of 2 mL trypsin-EDTA (T3924-500ML, Merck) was added to the cells and incubated at 37°C for 2 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... human MISSION esiRNA kntc2 (NDC80) (oligo #2, EHU042171-20UG, Merck), human ON-TARGETplus SMART pool NUF2 siRNA (L-005289-00-000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µg/mL Dox and 10 µM TMP (Merck, 92131) were used.
-
bioRxiv - Cancer Biology 2024Quote: ... 2 mM MgCl2) and incubated with 50 U Benzonase (Merck) for 1 h at 4 °C on a rotating wheel ...
-
bioRxiv - Biochemistry 2024Quote: RNA aliquots (2 μg) were treated with DNase (Merck, AMPD1) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... resuspended in 2 ml of 1XRIPA buffer (Merck, 20-188) with washed sonification beads ...
-
bioRxiv - Immunology 2021Quote: ... and washed by ultracentrifugation at 4°C using a 3 kDa filter (UFC900324, Merck-Millipore) to remove imidazole ...
-
bioRxiv - Developmental Biology 2024Quote: ... and left overnight at 4°C in blocking solution containing 3% Donkey Serum (D9663, Merck) and 0.03% Sodium Azide (40-2000-01 ...
-
bioRxiv - Biophysics 2024Quote: ... 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck KGaA (Darmstadt ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3T3-J2 fibroblasts were treated for 3 hours with 4 μg/mL mitomycin C (Merck) at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Genomics 2021Quote: ... Prior to protein quantification milk was diluted 1:2 in assay buffer (Merck-Millipore, Burlington, USA). Concentrations for 15 cytokines (IL-1α ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were 12 x serially diluted 1:2 in a 96-well plate (Merck, Darmstadt, Germany) starting with 4000 cells in the first column ...
-
bioRxiv - Microbiology 2024Quote: One mL of culture broth was mixed in a 2:1 ratio with chloroform (Merck, Mumbai), followed by centrifugation (15,300 g ...
-
bioRxiv - Neuroscience 2023Quote: ... Finally, clearing was performed in BABB (benzyl alcohol:benzyl benzoate 1:2, (Merck 8187011000 and Sigma 108006) for 48h.
-
bioRxiv - Microbiology 2023Quote: ... One mL of culture broth was mixed in a 2:1 ratio with chloroform (Merck, Mumbai), followed by centrifugation (15,300 g ...
-
bioRxiv - Neuroscience 2024Quote: ... the neuronal microtubule cytoskeleton was labeled using rabbit anti-MAP-2 (Merck Millipore, #AB5622, 1:800). Following three washes ...
-
bioRxiv - Biophysics 2024Quote: ... followed by 1 hour incubation with 2 mM methyl-β-cyclodextrin (MβCD) (Sigma-Aldrich/Merck, #C4555).
-
bioRxiv - Neuroscience 2020Quote: ... cryoprotected for 48 h in 20% sucrose at 4°C and then snap frozen in isopentane (2-methylbutane, Merck GmbH, Austria) for 3 min at −60°C ...
-
bioRxiv - Cell Biology 2022Quote: ... femurs and tibias of C57BL/6J mice were extracted and crushed on a mortar in PBS supplemented with 4%FBS and 2 mM EDTA and filtered through 0.45μm strainers (Merck Millipore, Cat#SLHV033RB). For B cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... ethyl acetate p.a (Merck), KBr Pro spectrophotometry ...
-
bioRxiv - Immunology 2022Quote: [12C4]-ethyl acetoacetate (Merck) and [13C4]-ethyl-acetoacetate (Cambridge Isotope labs ...
-
bioRxiv - Bioengineering 2021Quote: Three sender area squares (3 × 3 mm) were put into a 24-well containing 300 μL of anti-His antibody (Merck, Germany, NOVG70796-3) (10 μg mL−1 in DPBS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... determined by means of quantitative NMR using TraceCERT® ethyl 4-(dimethylamino)benzoate from Merck as an internal calibrant [48 ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µM Carbonyl cyanide 3-chlorophenylhydrazone (CCCP; Merck, Cat. #C2759, Germany), 1 µM rotenone (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... 3’-diaminobenzidine (DAB; Merck, Germany). DAB polymerizes in contact with H2O2 in the presence of peroxidase ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 (mouse monoclonal from Merck), GABA A Receptor γ (guinea pig polyclonal from SYSY) ...
-
bioRxiv - Microbiology 2022Quote: ... 3 gr/L (Merck, Germany); Na2HPO4 ...
-
bioRxiv - Microbiology 2020Quote: ... SU5402 3 μM (SML0443; Merck); and DAPT 10 μM (D5942 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM MgCl2 (#105833, Merck), 2 mM EGTA (Triplex®VI #108435 ...