Labshake search
Citations for Merck :
501 - 550 of 2546 citations for 6 chloro 4 methyl 2 phenylimino benzo b thiophen 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Plant Biology 2020Quote: ... the strain was grown on solid King’s medium B (Pseudomonas agar F, Merck KGaA, 64271 Darmstadt, Germany) supplemented with 50 μg mL−1 rifampicin at 25°C in the dark for 3 days ...
-
bioRxiv - Synthetic Biology 2021Quote: ... with Hygromycin B resistance used as the selection marker as previously described.[49] Spermidine (Merck Life Sciences) was used to precipitate DNA onto gold particles of 0.3-3µm diameter (ChemPur) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were grown for 48h in serum-free ESGRO Complete Clonal Grade Medium (Merck, Cat# SF001- B) supplemented with 1000 U/ml LIF ...
-
bioRxiv - Cell Biology 2022Quote: ... at a final concentration of 5 μg/ml in M2 medium or Latrunculin B (428020-1MG, Merck) at a final concentration of 5 μM in M2 medium (to disrupt F-actin) ...
-
bioRxiv - Immunology 2023Quote: ... and interacting infected cell-invaded B cell doublet images acquired with ImageStream X MKII (Amnis/Merck Millipore) were analyzed by IDEAS 6.3 (Amnis/Merck Millipore/Luminex).
-
bioRxiv - Biophysics 2020Quote: ... one cycle for 5 min) in Amicon Ultra 100 kDa MWCO filters (Merck Millipore, Darmstadt, Germany) using reaction buffer (25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Immunology 2020Quote: ... Sporozoites were acquired after one wash in PBS using the ImageStreamX Mk II instrument (Merck Millipore) with a 60X objective for 15-20 min per sample ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... oocytes were incubated for one to three days at 19°C in 50% Leibowitz medium (Merck) supplemented with 0.25 mg/ml gentamicin ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µl T4 buffer and 2 µl 50% PEG4000 (Merck, Kenilworth, NJ). After incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µM epoxomicin and 50 µM (Z-LL)2-ketone (Merck Millipore) were added from stock solutions in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% Glucose (Merck; #1.08342.1000) as liquid medium].
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% Glucose (Merck; #1.08342.1000), either as liquid medium or supplemented with 2% Agar (Roth ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2% glucose (Merck) along with 2.5% (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM CaCl2 (Merck) including sequencing grade trypsin (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Merck, Darmstadt, Germany).
-
bioRxiv - Cell Biology 2019Quote: ... 2% PFA (103999, Merck), 2.5% gluteraldehyde (11614 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2% PFA (103999, Merck), 2.5% gluteraldehyde (11614 ...
-
bioRxiv - Immunology 2021Quote: ... + 2 μL H2O2 (Merck) in 20 mL citrate buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% Dabco (Merck, D27802) in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% donkey serum (Merck), 0.05% Triton-X-100 (Merck) ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.01% 2-Mercaptoethanol) (Merck) and incubated at 95°C for 10 min following a previously published protocol (Dehesh et al ...
-
bioRxiv - Immunology 2023Quote: ... rotenone (2 μM; Merck) and antimycin A (2 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2) Claret (Merck). The PKH-26 blasts were combined back with the claret LSCs and vice versa ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M MgSO4 (Merck), 670 mM CaCl2 (Merck ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M NaCl (Merck), 2 M KCl (Merck) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M KCl (Merck), 2 M MgSO4 (Merck) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM EGTA (Merck), and 5 mM MgCl2 (Merck ...
-
bioRxiv - Neuroscience 2019Quote: ... followed by 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB; 4% PFA in PB, pH 7.4; Merck).
-
bioRxiv - Cell Biology 2019Quote: ... washed with buffer B to stop the spheroplasting reaction and then washed into 10 % formamide (Merck Millipore S4117) in 2× SSC.
-
bioRxiv - Physiology 2020Quote: ... all the birds were challenged with the Coccivac B-52 live vaccine (Merck Animal Health; 1.3× recommended dose). The vaccination was completed at d 5 to facilitate uniform intake of coccidian oocysts by the birds ...
-
bioRxiv - Plant Biology 2019Quote: ... 0.8 % phytoagar (Duchefa) and 10 µg mL-1 Glufosinate-ammonium or 25 µg mL-1 hygromycin B (Merck) for herbicide selection ...
-
bioRxiv - Genomics 2021Quote: ... with A pestle ~10 times following B pestle ~20 times in lysis buffer [5 mM CaCl2 (Merck, A546282), 3 mM Mg(Ac)2 (Roth ...
-
bioRxiv - Immunology 2020Quote: ... Primed neutrophils were obtained by treating the cells for 25 mins with 10 μM cytochalasin B (Merck, #C6762) and 100 nM N-Formylmethionyl-leucyl-phenylalanine (fMLF ...