Labshake search
Citations for Merck :
501 - 550 of 2146 citations for 6 Methyl 5 propyl 4 1H pyrimidinone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... ton1a and pok1;2 plants were performed by spraying with 50 μM 6-Benzylaminopurine (BA Merck) and mock (NaOH) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% P/S and 6 ng/mL human insulin (I9278-5ML, Merck Life Science bv). The cell culture was checked for mycoplasma contamination with the MycoAlert® Mycoplasma Detection Kit (LT07-118 ...
-
bioRxiv - Biochemistry 2022Quote: ... Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin, Bovine Serum, 12659, Merck Millipore) powder solved in 1 × TBST ...
-
bioRxiv - Developmental Biology 2021Quote: ... The HPLC was equipped with a hydrophilic ZIC-pHILIC column (150 × 2.1 mm, 5 μm) with a ZIC-pHILIC guard column (20 × 2.1 mm, 5 μm, Merck Sequant). 5ul of each sample was used for each assay ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Microbiology 2022Quote: ... were washed with RPMI 2%G by applying 5 psi perfusion for 5 min using the CellASIC® ONIX2 microfluidic system (version 1.0.4 Millipore Merck). Yeasts were loaded into the CellASIC culture chambers by applying 8 psi for 5 s twice (Thomson et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were incubated with Prussian’s blue solution containing ferrocyanide acid solutions (5% Hydrochloric acid (HCl) and 5% potassium ferrocyanide (Merck)) at a 1:1 ratio for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 ml conditioned medium was centrifuged (5 min, 500g) and filtered through Amicon Ultra-0.5 Centrifugal Filter unit (Merck). Ammonia in TIFs and SCFs was then quantified using Dimension Ammonia assay (Siemens ...
-
bioRxiv - Cell Biology 2021Quote: The vessel lumen was washed 3 times with PBS ++ (PBS with 1mM CaCl2, 0.5mM MgCl2) and fixed with 4% paraformaldehyde (PFA, Merck, #30525-89-4) at 37°C for 15 min ...
-
bioRxiv - Plant Biology 2022Quote: ... The lysate was cleared by two centrifugations (4000 rpm, 10 min, 4 °C and 20000g, 10 min, 4°C) and filtered (Miracloth, Merck 475855-1R). The lysate (input ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell lysates were centrifuged at 16,000 x g for 10 minutes at 4°C and the supernatants were then incubated overnight at 4°C with anti-Flag M2 affinity gel beads (Merck, Cat.N. A2220). M2 beads were then pelleted and washed three times with lysis buffer containing protease inhibitors ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were ultracentrifuged at 13000 rpm for 10 min at 4°C and concentrated to 1.5 ml using centrifugal filters (Merck, Amicon Ultra-4). They were then exchanged into buffer #5 overnight at 4°C and aliquoted and stored at -80°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were mounted in MOWIOL 4-88 (Merck-Millipore). All steps were conducted at room temperature and in the dark post-secondary antibody addition ...
-
bioRxiv - Neuroscience 2021Quote: ... coverslipped with 20 μl Mowiol® 4-88 (Merck Life Science UK Ltd ...
-
bioRxiv - Biochemistry 2020Quote: ... and 4 μg of unconjugated mouse IgG2a (Merck #M5409) per 100 μL for detection of CD235a ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by 4% (v/v) sodium hypochlorite (MERCK 1.93607.1021) containing 0.02% Triton X-100 for 3-min and rinsed three times with sterile distilled water ...
-
bioRxiv - Physiology 2021Quote: ... 0.004% (w/v) 4-hydroxybenzoate sodium salt (Merck, Germany)).
-
bioRxiv - Cell Biology 2021Quote: ... and with 4 μM CHIR99021 (Merck Millipore Sigma, USA) for one day ...
-
bioRxiv - Biophysics 2021Quote: ... and 4 mM of CaCl2 (Merck Life Science, Norway) (pH 7.8 adjusted with NaOH).
-
bioRxiv - Cell Biology 2022Quote: ... cultures were fixed in 4% paraformaldehyde (Sigma-Aldrich, Merck) for 30 min and washed in distilled water ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Physiology 2021Quote: ... 0.004% (w/v) 4-hydroxybenzoate sodium salt (Merck, Germany)).
-
bioRxiv - Developmental Biology 2022Quote: ... 4 mg/ml bovine serum albumin (BSA, Merck, A3311), penicillin-streptomycin (75 U/ml-60 μg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... filters were fixed in 4% paraformaldehyde (PFA; Merck, P6148) and permeabilized with 0.1% Triton X-100 (Merck ...
-
bioRxiv - Neuroscience 2022Quote: ... and sugammadex sodium (4 to 8mg/kg, i.v.; Merck Sharp & Dohme Corp. ...
-
bioRxiv - Neuroscience 2022Quote: ... Coverslips were mounted with Mowiol 4-88 (Merck Chemicals). For detection of Jacob-CREB and Jacob-LMO4 co-localization in STED imaging ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were fixed with 4% formaldehyde (Merck, Sigma Aldrich) in PBS (phosphate buffered saline ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then fixed with 4% paraformaldehyde (PFA; Merck) in PBS for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... using 4 µM calcium ionophore A23187 (cat. C7522, Merck). The GSK484 concentrations were 1 µM ...
-
bioRxiv - Microbiology 2023Quote: ... Tyrosol [2-(4-hydroxyphenyl) ethanol] (Merck Ltd., Budapest, Hungary) was prepared as a 0.1 M stock solution in sterile physiological saline.
-
Identification of resistance mechanisms to small-molecule inhibition of TEAD-regulated transcriptionbioRxiv - Cancer Biology 2023Quote: ... cells were fixed with 4% paraformaldehyde (Merck life sciences) and stained with 1µg/ml DAPI (Sigma Aldrich) ...
-
bioRxiv - Plant Biology 2024Quote: ... 4-trans-Abscisic acid (ABA; Merck, Rahway, NY, USA). Plates were kept in a germination chamber in the above conditions.
-
bioRxiv - Biochemistry 2024Quote: ... [pH 7.5] and 0.3% CHAPS (Merck, 331717-45-4)] supplemented with 500 nM Benzamidine (Benzamidine ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by mounting in Mowiol 4-88 (Merck, 81381). Samples were imaged on a Zeiss LSM 800 confocal microscope.
-
bioRxiv - Biophysics 2024Quote: ... and 2.5% BSA (Merck Millipore, Probumin #81-066-4). Primary antibodies (Santa Cruz Biotechnology ...
-
bioRxiv - Biochemistry 2024Quote: ... or a Sigma 4-16KS centrifuge (Merck, Darmstadt, Germany) under inert atmosphere ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Plant Biology 2024Quote: ... The extracts were spotted on a 5 cm x 5 cm TLC Silica gel 60 F₂₅₄ plate (Merck, Darmstadt, Germany). The blots were stained by spraying with a methanolic solution including 1% diphenylboric acid 2- aminoethylester (DPBA ...
-
bioRxiv - Genetics 2024Quote: ... 90%, 100% ethanol, 5 min each), cleared in xylene (twice, 5 min each) and mounted with DPX mounting medium (Merck).
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Molecular Biology 2021Quote: ... Chromatin corresponding to 13 μg of DNA was diluted 10-fold in RIPA buffer without SDS complemented with protease inhibitors and incubated overnight at 4°C with 4 μg of H3K9me3 or H3K27me3 antibodies (Frapporti et al., 2019) or with 4 μL of H3K4me3 monoclonal antibody (Merck Millipore #04-745). As input control ...