Labshake search
Citations for Merck :
501 - 550 of 4780 citations for 3 Methyl 1 6 naphthyridine 2 carboximidamide hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Transfections were carried out in 6 well plates using GeneJuice (Merck) with 1 μg of plasmid DNA per well ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting product was cloned into a pBAC-6 vector (Merck) by In-Fusion cloning (Clontech) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.8 mM glycine (Merck/Sigma-Aldrich, CAS number : 56-40-6), 0.2 mM L-histidine (Merck/Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SCD-MSG medium consisted of 0.17% yeast nitrogen base without amino acids and ammonium sulfate (Formedium ...
-
bioRxiv - Biophysics 2024Quote: ... 2 µM porcupine inhibitor IWP-2 (Sigma-Aldrich/Merck, I0536) was added to suppress secretion of endogenous Wnts ...
-
bioRxiv - Microbiology 2023Quote: ... IL-2 (Merck), JQ-1 (Sigma Aldrich) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 μL (equivalent to 3 mg cell dry weight) were spotted on HPTLC silica gel 60 plates (Merck) and developed in chloroform/methanol/13 M NH3/1 M NH4Ac/water (180:140:9:9:23 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 × 105 Cas9 TNG MKOS MEFs were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3% BSA followed by overnight incubation at room temperature with rabbit anti-KCC2 IgG (1:1000 dilution; #07-432, Merck-Millipore) (Yassin et al. ...
-
bioRxiv - Cell Biology 2023Quote: J774A.1 macrophages with or without infection (3 hour) were lysed in a specific lysis buffer containing DCP-Bio1 (Merck # NS1226) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were washed in PBS for 3 times and Alexa Fluor 555 conjugated secondary goat anti-mouse IgG antibody (1:100; Merck, Germany) was added for immunostaining in the dark for 2 hours at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of Protein powder solutions (1 mg/ml) were added to 3 cm NG plates with 10 µM 5-FU (Merck, #F6627). After the plates had dried ...
-
bioRxiv - Bioengineering 2024Quote: ... The activated microgels were then resuspended in 3 mL of PBS and 50 µL of 100 U mL−1 thrombin (Merck T1063) and stirred at room temperature overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 4.2) and 4-methylumbelliferyl-2-acetamido-2-deoxy-b-D-glucopyranoside (2 mM; #474502, Sigma-Aldrich/Merck). The reaction was stopped by 5 volumes of glycine and Na2CO3 ...
-
bioRxiv - Immunology 2024Quote: ... cells were pretreated with Interleukin-2 (IL-2, 20 nM, Merck) and Phytohemagglutinin (PHA ...
-
bioRxiv - Cell Biology 2024Quote: ... 2% 1,4-di-azo-bicyclo-2(2,2,2)-octane (Merck, Darmstadt, Germany)) ...
-
bioRxiv - Biophysics 2021Quote: ... for 1 min in O2 plasma and incubating them with fibronectin (2 μg/mL) (Merck, Darmstadt, Germany) in 100 mM NaHCO3 (pH 8.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... vigorously vortexed for 1 min and leukocytes retrieved by centrifugation were fixed using 2 % paraformaldehyde (Merck #158127) on ice for 10 min and washed with PBS-0.1 % sodium azide solution.
-
bioRxiv - Cancer Biology 2022Quote: ... Phophorylated MEK was detected using anti-phospho MEK 1/2 (residues 218/222 and 222/226, MERCK, catalogue No ...
-
bioRxiv - Cell Biology 2023Quote: ... Lipids were dissolved in chloroform:methanol (2:1, v:v) and separated by TLC on silica gel 60 (Merck) along with a standard ...
-
bioRxiv - Immunology 2023Quote: ... were premixed at a 1:9 molar ratio or a 2:98 molar ratio in chloroform (Merck) to arrive at PLBs harboring Ni-DOGS-NTA at 10% or 2% ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 0.43 mM MgCl2) with the addition of 0.2 mM 1-phenyl-2-thiourea (PTU, Merck, Germany) to block pigmentation ...
-
bioRxiv - Cell Biology 2023Quote: ... and fertilized eggs were cultured in EmbryoMax KSOM Medium (1X) w/ 1/2 Amino Acids (Merck Millipore) at 37°C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.43 mM MgCl2) with the addition of 0.2 mM 1-phenyl-2-thiourea (PTU, Merck, Germany) to block pigmentation ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Neuroscience 2024Quote: ACS was prepared from astrocyte cultures with aNSPC medium and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243 to obtain a < 3 kDa and a > 3 kDa fraction ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μl 40 mM glucose-6-phosphate (Sigma-Aldrich, now Merck KGaA) and 20 μl 35 mM NADP+ (KMF OptiChem ...
-
bioRxiv - Bioengineering 2020Quote: ... insulin (n=6; 20 U, Vetsulin, Merck Animal Health, Madison, NJ, USA), 2-deoxy-D-glucose (n=6 ...
-
bioRxiv - Immunology 2021Quote: ... mature macrophages (n=6 individual donors) were detached using Accutase (Merck Millipore), blocked with 10% pooled human serum in PBS for 30 minutes and incubated with various concentrations of rRABV-tG (0-100 μg/mL ...
-
bioRxiv - Plant Biology 2024Quote: ... and 0.36 U glucose-6-phosphate dehydrogenase (G6PDH) (G7877; Sigma-Aldrich/Merck) to each tube ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μM 6-benzylaminopurine (BAP; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.2 mL of a 0.2 M acetylacetone (Merck, cat# 123—54-6) solution was added to the former solution and kept in a water bath at 70°C for 10 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Supernatants were loaded to HybridSPE-Phospholipid cartridges (500 mg/6 mL, Merck) prewashed with 12 mL MeOH and 12 mL ACN containing 0.5% CA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 53.29 mM D-(+)-xylose (Merck/Sigma-Aldrich, CAS number : 58-86-6), 49.37 mM sodium succinate dibasic (Merck/Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...