Labshake search
Citations for Merck :
501 - 550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... These samples were stored in the dark and analyzed colorimetrically using a commercial kit (Spectroquant Sulfide kit, Merck, Schaffhausen, Switzerland). Total particulate nitrogen and carbon were determined by filtration of 100 to 220 mL lake water on pre-combusted (400°C ...
-
bioRxiv - Microbiology 2024Quote: ... and a crystal violet solution (0.1% crystal violet (Merck, Germany), 0.04% ethanol ...
-
bioRxiv - Microbiology 2024Quote: ... 10 mM Tris-HCl pH 8.0 (Merck, USA), and 1% SDS (Nacalai Tesque ...
-
bioRxiv - Microbiology 2024Quote: ... 0.075% sodium bicarbonate (Merck, USA), and 2 µg/mL trypsin-TPCK ...
-
bioRxiv - Microbiology 2024Quote: ... We stored them at -80 °C in phosphate buffered saline (PBS) with 20 % (v/v) glycerol (anhydrous; Merck, Darmstadt, Germany) and cultivated the isolates on Columbia blood agar plates containing 5 % sheep blood (Mast Diagnostica ...
-
bioRxiv - Neuroscience 2024Quote: ... and HET0016 (100 µM, Merck, SML2416-5MG) in DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: ... Viruses were collected from the supernatant 24 h later and cleared by centrifugation at 2,000 r.p.m for 5 min followed by filtration with 0.45μm PVDF syringe filter units (Merck) and stored at –80 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... coding sequences of AtCFI25a and AtCFI59 were cloned into pGEX5X-2 (GST) (Merck/GE Healthcare, Darmstadt, Germany) or pET30c (HIS ...
-
bioRxiv - Genetics 2024Quote: ... This iPS cell line was obtained by reprogramming of a commercial fibroblast cell line (FibroGRO™ Xeno-Free Human Foreskin Fibroblasts, #SCC058, Merck Millipore, Germany). Patients’ hiPSC cell lines were obtained by reprogramming of skin primary fibroblasts from ...
-
bioRxiv - Molecular Biology 2024Quote: 6 mL bone extraction buffer (1 M Trizma base, 0.1 M NaCl, 50 mM TitriplexIII (Merck), 0.5% SDS (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... Thorough vortexing and centrifugation at 11,000 rcf for 5 min was repeated and the upper water phase containing DNA was carefully transferred to a microfuge tube with 0.5 mL H20 saturated n-butanol (Merck). Tubes were vortexed and centrifuged at 11,000 rcf for 5 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Molecular Biology 2024Quote: ... sonicated and centrifuged and the supernatant passed through Amicon 30K Ultra-0.5 mL Centrifugal Filters (Merck Millipore, UFC503008) by centrifugation ...
-
bioRxiv - Immunology 2024Quote: ... Water from Milli-Q Advantage A10 and MultiScreen-HV 96-well Plates were used (Merck Millipore). Calibration ranges were 3.125 – 200 ng/mL for U and 25 - 500 ng/mL for UH2 and 5-FU (5µg/mL ...
-
bioRxiv - Developmental Biology 2024Quote: ... anti-O-GlcNAc clone RL2 (abcam #ab2739 and Merck Millipore #MABS157), anti-O-GlcNAc clone HGAC85 (ThermoFisher #HGAC85) ...
-
bioRxiv - Neuroscience 2024Quote: ... Three baseline recordings were taken followed by three recordings after each of the following subsequent injections: 1 μM Oligomycin (Merck), 1 μM FCCP (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... and Nissl-stained (cresyl violet, Merck, Darmstadt, Germany). Reconstruction of electrode penetrations in several experiments verified that our recordings were taken at intervals of 100 microns through a transect passing across layers of the SC ...
-
bioRxiv - Neuroscience 2024Quote: ... buffer and amino acids were obtained from Merck| Sigma-Aldrich ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... The cells were then blocked with 1× blocking solution (Merck, DUO92102) for 1 h at 37°C in a humidity chamber ...
-
bioRxiv - Molecular Biology 2024Quote: ... acidocaldarius MW001 cultures were supplemented with 10 µg/mL uracil (min. 99%, Merck, Germany). Transformed clones of S ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 15% sodium hypochlorite (Merck, 1056142500). Sodium hypochlorite solutions for assays were made fresh ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3% sodium nitroprusside (Merck, S0501), 2.5% menadion (Merck ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5% hydroxyurea (Merck, H8627-1G), 3% sodium nitroprusside (Merck ...
-
bioRxiv - Genomics 2024Quote: ... Steriflip vacuum-driven filtration system with 20 µm nylon net filter (Merck Millipore, Cat. no. SCNY00020), 40 µm polypropylene framed cell strainers (Biologix ...
-
bioRxiv - Molecular Biology 2024Quote: Cultured HAEC cells were stained for SA-β-galactosidase according to the manufacturer’s protocol (Merck Millipore). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells pellet was resuspended with a freezing medium composed of 90% KSR and 10% of Dimethyl Sulfoxide (DMSO, #D2438, Merck). Cell vials were stored in a liquid nitrogen tank.
-
bioRxiv - Molecular Biology 2024Quote: ... and 80 µL of Chloroform (Merck). Samples were centrifuged at 16,000×g for 10 min at 4°C or ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were grown in the presence and absence of 1 μg/ml tetracycline (Sigma-Aldrich / Merck) for RNAi induction ...
-
bioRxiv - Molecular Biology 2024Quote: ... S5B were dissociated with AccutaseTM (#A6964, Merck) and incubated onto poly-L-lysine (#P4832 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5G4-aggregated aSyn (MABN389, Merck).
-
bioRxiv - Molecular Biology 2024Quote: ... and purified using a 0.45-μm filter (Millex-AA; Merck Millipore, Darmstadt, Germany). The filtered viral particles were centrifuged at 8,000× g for 35 min at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... For liquid chromatography a SeQuant ZIC-pHILIC 5 μm Polymeric column 150 * 2.1 mm (Merck Millipore, Darmstadt, Germany) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... of 50 mM stocks of Ac4ManNAz (Custom synthesis by Synvenio) were prepared in sterile DMSO (Merck). The metabolic labeling was done with 100 µM Ac4ManNAz ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10% FCS (Merck), 2mM L-Glutamine (Gibco ...
-
bioRxiv - Molecular Biology 2024Quote: The cell pellet was fixed in a mixture of 4% formaldehyde and 0.1% glutaraldehyde in 0.1M HEPES (Sigma-Aldrich / Merck) for 1 h at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were selected with Phleomycin (Sigma-Aldrich / Merck) at 2.5 μg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sections were treated with blocking buffer (TEM-BB) composed of 1% fish skin gelatin (Sigma-Aldrich / Merck) dissolved in 0.1M HEPES for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... we treated keratinocytes with with 5 μg/mL Actinomycin D (Merck KGaA, Darmstadt, Germany) multiple time points ...
-
bioRxiv - Molecular Biology 2024Quote: Magna MeRIPTM m6A Kit (17-10499, Merck) was used to enable identification and transcriptome-wide profiling of m6A ...
-
bioRxiv - Molecular Biology 2024Quote: ... integrity was inspected on 1% agarose gel in TAE buffer pre-stained with GelRed nucleic acid stain (Merck).
-
bioRxiv - Molecular Biology 2024Quote: ... was filtered through a 0.45 μm syringe filter and 50-60× concentrated using Amicon Ultra-15 100 kDa NMWCO columns (#UFC910024, Merck Millipore). The resulting concentrate was aliquoted and stored at -80°C until further use.
-
bioRxiv - Developmental Biology 2024Quote: ... dissected and finally fixed in paraformaldehyde (PFA, Merck) 2% in PBS overnight at 4◦C or placed in pre–equilibrated culture medium.
-
bioRxiv - Neuroscience 2024Quote: ... Stocks were then mixed into equal volumes of 2X Laemmli buffer (Merck: S3401-10VL) and boiled for 10 minutes at 98 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Neuroscience 2024Quote: ... transferred into Immobilion-PVDF membranes (Merck Millipore, Madrid, Spain) and probed with antibodies against ...
-
bioRxiv - Neuroscience 2024Quote: ... Cytosine β-D-arabinofuranoside hydrochloride (Ara-C) (cat# C6645) (both from Merck, Auckland, NZ). BDNF (cat# RDS248BDB050) ...
-
bioRxiv - Molecular Biology 2024Quote: ... After the incubation period the supernatant was removed and the samples were further incubated with 150 μl of 51.5 mM IAA (Merck Millipore) diluted in 50 mM NH4HCO3 (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... puromycin (Merck Millipore; #540411; solved in ddH2O), Biotin (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... proteins were detected by using enhanced chemiluminescence (ECL) systems from Merck Millipore (Immobilon Western Chemiluminescent HRP Substrate ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were stripped with 1X ReBlot Plus Strong Antibody Stripping Solution (#2504, Merck Millipore), blocked for 30 minutes in blocking milk ...