Labshake search
Citations for Merck :
451 - 500 of 1428 citations for Recombinant Human LDLR protein GST tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... the proteins were transferred into nitrocellulose membranes (Merck-Millipore, Germany) for 2h at 300 mV using an electrophoretic transfer system (BioRad) ...
-
bioRxiv - Biophysics 2023Quote: ... All protein preparations were concentrated using Amicon Ultracentrifugal filters (Merck), reduced with DTT and purified by reversed-phase high-performance liquid chromatography (RP-HPLC ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein extracts were supplemented with 0.5 mM cycloheximide (CHX; Merck), and the mixtures were then divided in two parts ...
-
bioRxiv - Molecular Biology 2023Quote: ... 30 μL Magna ChIP™ protein G magnetic beads (Merck) per IP were washed with PBS-Tween 0.1% three times ...
-
bioRxiv - Neuroscience 2023Quote: ... We determined protein concentration with Bradford reagent (Merck Life Sciences). We treated lysate samples (20 µg ...
-
bioRxiv - Genomics 2023Quote: ... per 20 μl of protein A/G MagnaBeads (Merck Millipore). Beads were then washed once with low salt wash buffer (0.1% SDS ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were blotted onto a PVDF membrane (Merck Millipore, IPVH00010) or nitrocellulose membrane (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... The proteins were electroblotted onto Immobilon-P transfer membranes (Merck). Thereafter ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and was established using the following standard proteins (Merck MWGF1000): carbonic anhydrase (CAN ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were transferred to PVDF Immobilon-FL membranes (Merck Millipore) using the Power Blotter Semi-dry Transfer System (Thermo Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were incubated with protein G-agarose beads (11719416001, Merck) in IP buffer overnight at 4 °C with rotation ...
-
bioRxiv - Plant Biology 2024Quote: ... proteins were transferred onto a 0.45µm PVDF membrane (Immobilon, Merck). The membranes were stained with a 1:1 mix of glacial acetic acid and Ponceau Red (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... 5 ml of BugBuster Protein Extraction Master Mix (Merck KGaA) was added ...
-
bioRxiv - Biochemistry 2024Quote: ... the protein was concentrated using an Amicon Stirred Cell (Merck) equipped with a 100 kDa molecule weight cut off (MWCO ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein concentrations were determined using the BCA assay (Merck-Millipore) and the proteins were digested overnight at 37°C using 100:1 protein:trypsin ratio (Promega) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... proteins were concentrated using 3,000 MWCO centrifugal filters (Merck, UFC500396) and protein concentrations were quantified by Bradford Assay (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... The MILLIPLEX®MAP Human Isotyping Magnetic Bead Panel-Isotyping Multiplex Assay (HGAMMAG-301K-06, Merck) was used to measure IgG1 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Human Caco-2 colorectal adenocarcinoma cells (1.7×105 cells/cm2) were cultured in DMEM medium (Merck) containing 10% FCS at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... medium was further exchanged with FibroGRO™ Complete Media Kit for Culture of Human Fibroblasts (Merck), consisting of a fibroblasts-specific basal media supplemented with P/S (0.5%) ...
-
bioRxiv - Microbiology 2023Quote: ... and mouse anti-human TMPRSS2 (monoclonal, clone P5H9-A3, cat num: MABF2158, 1:500, MERCK, USA) for a minimum of 2 h at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mg/l hydrocortisone and 1 µg/l and human epidermal growth factor (hEGF) (both Merck). To determine EC sex ...
-
bioRxiv - Neuroscience 2024Quote: Rodent as well as human brain slices were stained using the antibodies NeuN (MAB377, MilliporeSigma (Merck), 1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... Human embryonic kidney (293T) cells were maintained in the Dulbecco’s Modified Eagle Medium (D6046, Merck, Darmstadt, Germany) supplemented with 10% fetal bovine serum (FB-1365 ...
-
bioRxiv - Bioengineering 2021Quote: The sEVs used to validate the platform were collected from a commercial human serum purchased from Merck Millipore (same lot in all preparations ...
-
bioRxiv - Neuroscience 2021Quote: ... The concentrations of Aβ40 and Aβ42 were determined in brain lysates using the ELISA kits according to the manufacturer’s instructions (human Aβ40 and Aβ42 brain ELISA, Merck).
-
bioRxiv - Genomics 2022Quote: ... females and males were primed with 20 U and 10 U human chorionic gonadotropin (hCG, Pregnyl, Merck), respectively ...
-
bioRxiv - Immunology 2022Quote: ... Human peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll density gradient centrifugation (GE-171440-02, Merck), collected from the interphase ...
-
bioRxiv - Neuroscience 2022Quote: ... C3 and C1 were analyzed with HCMP2MAG-19K-02 Human Complement Magnetic Bead Panel 2 (Merck Millipore). Supernatants from non-stimulated CTL and L2-PD astrocytes cultured for 14 days were collected and stored at −80°C for long storage ...
-
bioRxiv - Cell Biology 2023Quote: ... fully mature Xenopus females were injected with 260 U of human chorionic gonadotropin (hCG; Merck, Ovitrelle 250G) into the dorsal lymph sac about 12-16 h before use and kept overnight at 18 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were sub-cultured on days 4 and 8 of differentiation onto human fibronectin (Merck Millipore, #FC010) coated plates at a ratio of 1:4 ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cell Biology 2024Quote: The EMD MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Pane A – Immunology Multiplex Assay (Merck Millipore) was employed to simultaneously analyze TNF-α ...
-
bioRxiv - Biophysics 2021Quote: ... Pooled protein fractions were concentrated with Amicon-Ultra-15 (Merck KGaA) to 11.2 mg ml−1 as measured by the absorbance at 280 nm ...
-
bioRxiv - Cell Biology 2020Quote: ... Separated proteins were transferred to PVDF-FL transfer membrane (Merck Millipore) at 40V for 90 min at 4 °C ...
-
bioRxiv - Developmental Biology 2020Quote: ... Protein concentrations were determined by Direct Detect® Infrared Spectrometer (Merck).
-
bioRxiv - Cell Biology 2022Quote: ... was used to transfer proteins to PVDF Immobilon membranes (Merck Millipore). Blocking and antibody incubation steps were performed in EveryBlot Blocking Buffer (BioRad) ...
-
bioRxiv - Neuroscience 2020Quote: ... the protein solution was filtered through 100 kDa filter (MERCK, MRCFOR100). The filtrate was transferred to a low-protein binding tube and 30 equivalents of HNE (Cayman Chem ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was concentrated in Amicon centrifugal filters (10 KDa, Merck) in presence of 1:10 GCDCA ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoreactive proteins were visualized by Immobilion western chemiluminescence substrate (Merck-Millipore). Densitometry was carried out by FIJI.
-
bioRxiv - Cell Biology 2021Quote: ... The proteins were transferred to an Immobilon-P Transfer Membrane (Merck), blocked with 10% Blocking One (nacalai tesque) ...
-
bioRxiv - Biochemistry 2020Quote: ... The proteins were then transferred to a PVDF membrane (Merck Millipore) using a semi-dry western blot transfer system set to a constant current of 200 mA for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... proteins were transferred onto the PVDF membrane (Immobilon-FL, Merck-Millipore). After the electrotransfer ...
-
bioRxiv - Physiology 2021Quote: ... breast cancer resistance protein (Bcrp-1:100; Merck Millipore, Massachusetts, USA) or Abcg1 (1:200 ...
-
bioRxiv - Cell Biology 2020Quote: Proteins were transferred onto a PVDF membrane (Immobilon-P, Merck Millipore) using wet transfer ...
-
bioRxiv - Biophysics 2022Quote: ... The proteins were concentrated using the Amicon Ultra centrifugal filters (Merck) by replacing the buffer with 20 mM Tris-HCl (pH 7.4) ...
-
bioRxiv - Biophysics 2020Quote: ... Protein fractions were pooled and concentrated (10.000 MWCO Amicon; Merck-Millipore) up to 5 mL and analyzed on a HiLoad 26/60 Superdex 200 (GE ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein bands were detected using enhanced chemiluminescence (Luminata Crescendo, Merck Millipore). Membranes were re-probed with β-Actin antibody to ensure equal loading.
-
bioRxiv - Biophysics 2021Quote: ... The proteins were concentrated with 50 kDa MWCO Amicon filters (Merck) to around 3-4 mg/ml for subsequent structural studies.
-
bioRxiv - Developmental Biology 2022Quote: ... Protein bands were visualized in ECL solution (Merck KGaA, Darmstadt, Germany) using an ImageQuant LAS4000 (GE Healthcare) ...