Labshake search
Citations for Merck :
451 - 500 of 4688 citations for 7 Quinolinecarboxylicacid 1 2 3 4 tetrahydro 1 methyl 2 oxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The blots were incubated with primary antibodies to the following proteins overnight at 4 °C: (1) CTCF (1:1,000; 07-729, Merck Millipore), (2 ...
-
bioRxiv - Bioengineering 2022Quote: ... gels were washed for around 2-4 h with PBS and incubated in 1 ml 1 μM Alexa Fluor 546 NHS ester (NHS-AF546, #A20002, Merck), overnight at room temperature on a slowly rotating shaker ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated for 48 h with 3 μM 4-hydroxytamoxifen (Merck) and then kept in 300 nM until experimentation ...
-
bioRxiv - Microbiology 2021Quote: 2mL SARS-CoV-2 P4 supernatant containing 2 x 107 pfu/mL was purified using an Amicon Ultra column (MWCO 100kDa; Merck) by centrifugation and washing in PBS at 2,000 x g ...
-
bioRxiv - Immunology 2023Quote: ... Cells were transferred to plates, and then washed in 100-200 μL FACS buffer (PBS containing 2% FCS, 2 mM EDTA (Merck) and centrifuged at 400 x g for 5 mins ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Neuroscience 2019Quote: ... further immunolabeling was used either against Vesicular Glutamate Transporter 3 (1:2000, VGluT3; Merck, Cat#AB-5421 ...
-
bioRxiv - Molecular Biology 2022Quote: ... faecalis was diluted 1:100 into 3 L of Brain heart infusion (BHI, Merck) and grown at 37°C ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mM DTT) and concentrated using a 3 kDa MWCO Centriprep concentrators (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM L-Glutamine (Sigma-Aldrich; Merck KGaA) and 100 μM 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM L-glutamine (Sigma-Aldrich, Merck #59202C) and penicillin (100 U/ml)/streptomycine (100 µg/ml) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Treatment of 2 µg/ml Dox (Merck, D9891) with 10 nmol/L TMP (Merck ...
-
bioRxiv - Genetics 2021Quote: ... 2 μl H3K4me3 antibody (07-473, Merck-Millipore), 5 μg H3K27ac antibody (Active Motif ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM protocatechuic acid (cat. no. 03930590, Merck) and 0.1 μM protocatechuate 3,4-dioxygenase (cat ...
-
bioRxiv - Biochemistry 2020Quote: ... Escherichia coli Rosetta 2 (DE3) bacteria (Merck millipore) transformed with the pET21b (Merck millipore ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with 2 mg/mL lysozyme (Merck KGaA), 20 units/mL Benzonase (Merck KGaA) ...
-
bioRxiv - Cell Biology 2022Quote: ... rat immunoglobulin (Ig) G (Merck, 2-5μg/ml), U0126 (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-deoxyglucose (Sigma/Merck; radiolabelled 2DOG from PerkinElmer) was added to each well to a final concentration of 50 μM and 0.25 μCi/well ...
-
bioRxiv - Microbiology 2020Quote: ... and MHA supplied 2% glucose medium (MHGA - Merck) were used for determination antibacterial and antifungal activity ...
-
bioRxiv - Microbiology 2021Quote: ... Sections were stained with 2% uranyl acetate (Merck) and lead citrate (Agar ...
-
bioRxiv - Developmental Biology 2021Quote: ... mitochondrial pellets were lysed with 2% CHAPS (Merck) in Tris-buffered saline (TBS ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-mercaptoethanol and EDTA were obtained from Merck. Precision Plus-Dual Color protein standards and Sypro Ruby were from BioRad ...
-
bioRxiv - Bioengineering 2022Quote: ... 2 mM EGTA (Triplex®VI #108435, Merck), 320 mM sucrose (#107651 ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 ml methacrylic anhydride (Sigma-Aldrich; Merck KGaA) was added dropwise with vigorous stirring ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2% dextrose (Merck/Sigma-Aldrich cat. no. 49139), 40 mg/L adenine sulphate (Amresco 0607-100G ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 2 mM orthovanadate (Merck-Sigma, Molsheim France), phosphatase inhibitor cocktail II (Merck-Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... snap frozen in isopentane (2-methylbutane, Uvasol, Merck) and kept in dry ice for cryoprotection ...
-
bioRxiv - Immunology 2023Quote: ... 200 mM NaCl and 2 mM EDTA (Merck) and finally dissolved in 6 M guanidine hydrochloride (Merck) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 mM L-glutamine (Merck Life science). Cells were grown at 37 °C under 6% CO2 atmosphere ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM vanadyl ribonucleoside complexes (VRC, Merck, R3380)] ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 1h and 2% glacial acetic acid (Merck) for 1h ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 2% bovine serum albumin (BSA; A9418; Merck) and 1% GlutaMax ...
-
bioRxiv - Cell Biology 2024Quote: ... growth medium containing 2 µM CHIR99021 (Merck 361559) and 10% fetal bovine serum (Gibco 16140071 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Following permeabilization with 2% TritonX (1.12298.0101, Merck Millipore) and blocking using 5% BSA (3737.4 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 µl pure trifluoroacetic acid (TFA, Merck). In samples destined for 4-ONE analysis ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.05 mM 2-mercaptoethanol (Sigma-Aldrich, Merck). For differentiating to macrophages ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 mM of magnesium chloride (ref 1.05833, Merck) 150 mM of Sodium Chloride (ref S3014 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rinsed with PBS and the proteins were visualized with Immobilon Western Chemiluminiscent HRP substrate (Merck/Millipore, used at 1:1:3 (H2O) dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked again and incubated overnight at 4°C with DAPI (1:2000) (Merck) and anti-rabbit AlexaFluor-488 (1:500 ...
-
bioRxiv - Biophysics 2022Quote: ... sucrose and methyl-β-cyclodextrin (mβCD) were obtained from Merck KGaA ...
-
bioRxiv - Developmental Biology 2023Quote: ... to which 10 µg/mL of methyl stearate (Merck, Singapore) was added as an internal standard ...
-
bioRxiv - Biochemistry 2022Quote: ... EGTA-eluates were pooled and concentrated to a final concentration of ∼2 mg/ml using an Amicon Ultra-4 cellulose centrifugal filter unit (Merck Millipore, Cat# UFC810024).
-
bioRxiv - Pathology 2023Quote: Cryosections of formalin-fixed lung tissue 7 μm thick were washed in PBS and permeabilized for 1 h with 0.01% Tween 20 (Sigma-Merck, Germany), followed by three washes in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... blots were blocked for 1 h and incubated overnight at 4 °C with anti-Amyloid fibrils (OC, 1:5000, Merck-Millipore), anti-prefibrillar oligomers (A11 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were centrifuged for 5 min at 20 000 x g and supernatants were immunoprecipitated for 1 h rotating at 4°C with mouse anti-GFP antibody (1 µg antibody per sample, 11814460001 Merck/Sigma) and 20 µl DynabeadsTM Protein G (10004D ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Biophysics 2022Quote: ... 2 mL of EV-containing eluate was collected and concentrated to 100 μL using Amicon Ultra-2 10K filters (Merck Millipore).
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 ml nuclei wash, and suspension buffer (NWS-Buffer: 2% BSA, 2 mM MgCl2, 0.5% Protector RNAse Inhibitor (SKU3335399001, Merck, Soeborg, Denmark)) was carefully added ...